\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003397130:

Variant ID: vg1003397130 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3397130
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGTGCAATTTTTTCCAAGTTCAAGATTCCAAGACCCCCATAATCCTTTGGCTTGCAAACATAGTTCCAATTTAGAAGGCAGCTTCCCGCACAGACGTT[G/A]
TCCGAGTCATCTTCTTTCTAGAGGAAAGCTCGTCTAAAATGATCAATCCGCTTATAAAGCCATTCATTCTATGGTAGAACTGTAAGGTGGTAGATAGGTG

Reverse complement sequence

CACCTATCTACCACCTTACAGTTCTACCATAGAATGAATGGCTTTATAAGCGGATTGATCATTTTAGACGAGCTTTCCTCTAGAAAGAAGATGACTCGGA[C/T]
AACGTCTGTGCGGGAAGCTGCCTTCTAAATTGGAACTATGTTTGCAAGCCAAAGGATTATGGGGGTCTTGGAATCTTGAACTTGGAAAAAATTGCACGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 20.20% 0.04% 0.13% NA
All Indica  2759 74.40% 25.30% 0.07% 0.22% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 79.70% 20.20% 0.17% 0.00% NA
Indica II  465 55.70% 43.90% 0.00% 0.43% NA
Indica III  913 79.80% 19.80% 0.11% 0.22% NA
Indica Intermediate  786 75.10% 24.70% 0.00% 0.25% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003397130 G -> A LOC_Os10g06580.1 upstream_gene_variant ; 2116.0bp to feature; MODIFIER silent_mutation Average:83.72; most accessible tissue: Zhenshan97 panicle, score: 91.206 N N N N
vg1003397130 G -> A LOC_Os10g06600.1 downstream_gene_variant ; 669.0bp to feature; MODIFIER silent_mutation Average:83.72; most accessible tissue: Zhenshan97 panicle, score: 91.206 N N N N
vg1003397130 G -> A LOC_Os10g06580-LOC_Os10g06600 intergenic_region ; MODIFIER silent_mutation Average:83.72; most accessible tissue: Zhenshan97 panicle, score: 91.206 N N N N
vg1003397130 G -> DEL N N silent_mutation Average:83.72; most accessible tissue: Zhenshan97 panicle, score: 91.206 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1003397130 G A -0.02 -0.03 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003397130 9.93E-07 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 4.12E-07 3.53E-07 mr1538 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 6.69E-09 1.65E-07 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 8.72E-08 1.28E-09 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 1.24E-15 1.98E-17 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 2.79E-14 2.01E-17 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 NA 5.35E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 NA 4.81E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 4.50E-06 1.64E-09 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 1.46E-08 1.76E-07 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 4.70E-10 2.67E-11 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 2.36E-13 3.45E-22 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003397130 1.49E-09 4.32E-16 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251