\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003395810:

Variant ID: vg1003395810 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3395810
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGCAGCGCATGACGAGATCGGCGATGGCGGTGCTTGGAGGTAGCAGGTGCGGCGGCAATGACCGCCAACTGCGCATCAAGCCAGGATAGTGGCACAAG[G/A]
AAATCGCAGGCACAATGACGATGATGGCATGACAGTGGCGATGACAGCGATGGCATGGTAGGTGGGATCCCGCATCGAGCTCGACATCCACCTTTGGCTC

Reverse complement sequence

GAGCCAAAGGTGGATGTCGAGCTCGATGCGGGATCCCACCTACCATGCCATCGCTGTCATCGCCACTGTCATGCCATCATCGTCATTGTGCCTGCGATTT[C/T]
CTTGTGCCACTATCCTGGCTTGATGCGCAGTTGGCGGTCATTGCCGCCGCACCTGCTACCTCCAAGCACCGCCATCGCCGATCTCGTCATGCGCTGCTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 37.10% 0.91% 22.68% NA
All Indica  2759 56.80% 5.70% 1.45% 35.99% NA
All Japonica  1512 1.70% 95.80% 0.07% 2.45% NA
Aus  269 84.40% 12.60% 0.00% 2.97% NA
Indica I  595 54.10% 3.40% 2.02% 40.50% NA
Indica II  465 75.30% 0.90% 1.08% 22.80% NA
Indica III  913 41.00% 10.40% 1.42% 47.21% NA
Indica Intermediate  786 66.40% 5.00% 1.27% 27.35% NA
Temperate Japonica  767 0.50% 99.20% 0.00% 0.26% NA
Tropical Japonica  504 3.80% 89.50% 0.00% 6.75% NA
Japonica Intermediate  241 1.20% 97.90% 0.41% 0.41% NA
VI/Aromatic  96 3.10% 70.80% 2.08% 23.96% NA
Intermediate  90 36.70% 51.10% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003395810 G -> A LOC_Os10g06580.1 upstream_gene_variant ; 796.0bp to feature; MODIFIER silent_mutation Average:66.983; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1003395810 G -> A LOC_Os10g06600.1 downstream_gene_variant ; 1989.0bp to feature; MODIFIER silent_mutation Average:66.983; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1003395810 G -> A LOC_Os10g06580-LOC_Os10g06600 intergenic_region ; MODIFIER silent_mutation Average:66.983; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1003395810 G -> DEL N N silent_mutation Average:66.983; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003395810 1.83E-13 NA mr1538 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 2.72E-13 1.06E-14 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 6.00E-23 2.01E-15 mr1547 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 1.96E-19 7.98E-26 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 1.27E-38 5.47E-43 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 8.73E-42 3.21E-66 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 NA 4.65E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 7.53E-12 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 5.13E-15 2.40E-20 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 2.97E-20 1.51E-16 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 4.14E-23 1.35E-31 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 NA 1.07E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 2.92E-64 4.63E-69 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003395810 2.75E-61 5.34E-108 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251