\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003392770:

Variant ID: vg1003392770 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3392770
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCCACATGGAACCATGTAACTATTTAATGTATATATGTATGCTTTAACCAATGCAGCTTATAGCTAACTTGTAGTTAGTTTGTTGTATGAGTTGTCTC[T/C]
TTAAGTTAGCTCTATTTTAACATGACAAAATTTTGGAGCTTGCTGCTAGCTATACTATTGACCTTGCTCTGAGACAAGACTACCAATATTGCTAAGTTAC

Reverse complement sequence

GTAACTTAGCAATATTGGTAGTCTTGTCTCAGAGCAAGGTCAATAGTATAGCTAGCAGCAAGCTCCAAAATTTTGTCATGTTAAAATAGAGCTAACTTAA[A/G]
GAGACAACTCATACAACAAACTAACTACAAGTTAGCTATAAGCTGCATTGGTTAAAGCATACATATATACATTAAATAGTTACATGGTTCCATGTGGGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 0.10% 1.25% 22.20% NA
All Indica  2759 62.70% 0.00% 0.94% 36.28% NA
All Japonica  1512 97.50% 0.10% 2.12% 0.33% NA
Aus  269 97.00% 0.00% 0.00% 2.97% NA
Indica I  595 58.20% 0.20% 2.86% 38.82% NA
Indica II  465 76.30% 0.00% 0.00% 23.66% NA
Indica III  913 51.20% 0.00% 0.44% 48.41% NA
Indica Intermediate  786 71.60% 0.00% 0.64% 27.74% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 93.30% 0.20% 6.35% 0.20% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 74.00% 1.00% 0.00% 25.00% NA
Intermediate  90 85.60% 1.10% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003392770 T -> C LOC_Os10g06580.1 downstream_gene_variant ; 943.0bp to feature; MODIFIER silent_mutation Average:73.316; most accessible tissue: Callus, score: 97.823 N N N N
vg1003392770 T -> C LOC_Os10g06560-LOC_Os10g06580 intergenic_region ; MODIFIER silent_mutation Average:73.316; most accessible tissue: Callus, score: 97.823 N N N N
vg1003392770 T -> DEL N N silent_mutation Average:73.316; most accessible tissue: Callus, score: 97.823 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1003392770 T C 0.04 0.0 0.0 -0.04 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003392770 5.37E-12 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 4.45E-11 4.45E-13 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 6.28E-18 2.65E-22 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 1.09E-15 4.01E-21 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 1.33E-48 6.04E-58 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 2.09E-47 9.82E-73 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 NA 4.46E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 NA 6.62E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 NA 8.08E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 1.94E-14 NA mr1538_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 2.11E-13 3.23E-19 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 3.14E-21 8.08E-26 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 2.50E-19 1.40E-26 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 2.07E-78 3.43E-98 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003392770 1.86E-67 6.59E-105 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251