\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003340954:

Variant ID: vg1003340954 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3340954
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.07, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CATATGATCCTCTCGATCCTGGGGCTCGCCAGGATAGTAGCGGCCTCGGCGTGTGCTGGGTTTCTCGGGCACGTCGGGATGGACTCAGGATAATAGCGAC[G/T]
GCCATGGGCGCGTCGGGATGGGCTCAGGACGGCGGCAGCCACCATGGGCGCGGGACGCGAACCCGAGGAGAGAGATGAAGTGGAGGAAGAGATTGATGAG

Reverse complement sequence

CTCATCAATCTCTTCCTCCACTTCATCTCTCTCCTCGGGTTCGCGTCCCGCGCCCATGGTGGCTGCCGCCGTCCTGAGCCCATCCCGACGCGCCCATGGC[C/A]
GTCGCTATTATCCTGAGTCCATCCCGACGTGCCCGAGAAACCCAGCACACGCCGAGGCCGCTACTATCCTGGCGAGCCCCAGGATCGAGAGGATCATATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 20.00% 0.78% 8.65% NA
All Indica  2759 51.50% 32.80% 1.30% 14.46% NA
All Japonica  1512 99.30% 0.30% 0.07% 0.33% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 64.50% 26.20% 1.01% 8.24% NA
Indica II  465 60.90% 24.30% 0.86% 13.98% NA
Indica III  913 37.00% 47.20% 0.77% 15.01% NA
Indica Intermediate  786 52.80% 26.00% 2.42% 18.83% NA
Temperate Japonica  767 99.50% 0.40% 0.00% 0.13% NA
Tropical Japonica  504 98.80% 0.20% 0.20% 0.79% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 81.10% 13.30% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003340954 G -> T LOC_Os10g06500.1 missense_variant ; p.Arg16Ser; MODERATE nonsynonymous_codon ; R16S Average:78.852; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 unknown unknown DELETERIOUS 0.00
vg1003340954 G -> DEL LOC_Os10g06500.1 N frameshift_variant Average:78.852; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1003340954 G T -0.01 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003340954 2.12E-09 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 1.63E-09 2.95E-12 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 1.61E-15 6.39E-20 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 2.89E-13 5.34E-19 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 5.37E-38 3.34E-49 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 1.31E-32 1.72E-58 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 5.48E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 5.55E-06 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 1.61E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 7.86E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 1.57E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 1.84E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 3.78E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 1.93E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 5.42E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 1.42E-08 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 9.37E-10 4.35E-17 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 1.21E-14 7.54E-21 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 2.40E-14 1.03E-22 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 4.82E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 2.92E-60 4.34E-89 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 3.46E-46 1.45E-92 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 9.08E-06 mr1742_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003340954 NA 8.24E-06 mr1817_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251