Variant ID: vg1003336967 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 3336967 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 51. )
TTTTCTCTCCTCGGGAGAAGACTAGAAAACCGAGTTTGCCCGCCGGCACACCAAACACACACTTTTCGGGGTTCAGTTTCATGCGCGTTGACCTAAGGCT[G/A]
TCGAAAGTCTCAGCCAAGTCCTGTAATAACGTCTCCTGGTGGCGCGTCTTTACCACCAGGTCATCGACATACGCCTCTACATTGCGCCTTATTTGATTAC
GTAATCAAATAAGGCGCAATGTAGAGGCGTATGTCGATGACCTGGTGGTAAAGACGCGCCACCAGGAGACGTTATTACAGGACTTGGCTGAGACTTTCGA[C/T]
AGCCTTAGGTCAACGCGCATGAAACTGAACCCCGAAAAGTGTGTGTTTGGTGTGCCGGCGGGCAAACTCGGTTTTCTAGTCTTCTCCCGAGGAGAGAAAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 62.60% | 9.60% | 4.00% | 23.78% | NA |
All Indica | 2759 | 39.50% | 15.00% | 6.34% | 39.11% | NA |
All Japonica | 1512 | 96.90% | 2.30% | 0.26% | 0.53% | NA |
Aus | 269 | 97.00% | 0.00% | 0.00% | 2.97% | NA |
Indica I | 595 | 49.10% | 16.50% | 4.87% | 29.58% | NA |
Indica II | 465 | 47.10% | 14.20% | 5.16% | 33.55% | NA |
Indica III | 913 | 26.90% | 15.80% | 8.11% | 49.18% | NA |
Indica Intermediate | 786 | 42.50% | 13.50% | 6.11% | 37.91% | NA |
Temperate Japonica | 767 | 99.30% | 0.00% | 0.26% | 0.39% | NA |
Tropical Japonica | 504 | 92.10% | 6.70% | 0.40% | 0.79% | NA |
Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
VI/Aromatic | 96 | 75.00% | 0.00% | 4.17% | 20.83% | NA |
Intermediate | 90 | 77.80% | 5.60% | 6.67% | 10.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1003336967 | G -> A | LOC_Os10g06490.1 | synonymous_variant ; p.Asp592Asp; LOW | synonymous_codon | Average:29.346; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
vg1003336967 | G -> DEL | LOC_Os10g06490.1 | N | frameshift_variant | Average:29.346; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1003336967 | NA | 3.56E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003336967 | 6.27E-10 | 4.07E-09 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003336967 | 2.35E-08 | 9.50E-10 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003336967 | 7.79E-15 | 1.39E-13 | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003336967 | 1.37E-12 | 3.66E-11 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003336967 | NA | 4.40E-07 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003336967 | 3.07E-08 | 4.38E-09 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003336967 | 5.13E-09 | 1.18E-11 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003336967 | 9.53E-14 | 2.37E-12 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003336967 | 2.56E-09 | 1.96E-10 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |