\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003331343:

Variant ID: vg1003331343 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3331343
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCATCGTGGCCGTCTGCCATGGCCCGGCCGTGGATCTTGATCTCGGCCGTTCGTTTTGGATAGGATCGATCTCGGCCGTCCGTTCCCGTGAACCGCTGC[T/C]
GTGCGCCCGGTCCACCGCAAACCCTAGTTGCTGACGCAATAAACCCTTTTTCCTTTTCAAAAATAATTCGTTATTGCGTCATAATTCAATTAAAATCCAT

Reverse complement sequence

ATGGATTTTAATTGAATTATGACGCAATAACGAATTATTTTTGAAAAGGAAAAAGGGTTTATTGCGTCAGCAACTAGGGTTTGCGGTGGACCGGGCGCAC[A/G]
GCAGCGGTTCACGGGAACGGACGGCCGAGATCGATCCTATCCAAAACGAACGGCCGAGATCAAGATCCACGGCCGGGCCATGGCAGACGGCCACGATGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 38.70% 1.14% 0.28% NA
All Indica  2759 78.10% 20.30% 1.27% 0.29% NA
All Japonica  1512 20.10% 78.50% 1.06% 0.33% NA
Aus  269 94.40% 5.20% 0.37% 0.00% NA
Indica I  595 56.30% 41.50% 1.68% 0.50% NA
Indica II  465 86.00% 12.50% 1.08% 0.43% NA
Indica III  913 89.40% 9.60% 0.66% 0.33% NA
Indica Intermediate  786 77.00% 21.20% 1.78% 0.00% NA
Temperate Japonica  767 27.80% 72.20% 0.00% 0.00% NA
Tropical Japonica  504 6.30% 89.50% 3.17% 0.99% NA
Japonica Intermediate  241 24.50% 75.50% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 52.20% 45.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003331343 T -> C LOC_Os10g06460.1 upstream_gene_variant ; 3637.0bp to feature; MODIFIER silent_mutation Average:37.511; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1003331343 T -> C LOC_Os10g06470.1 upstream_gene_variant ; 80.0bp to feature; MODIFIER silent_mutation Average:37.511; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1003331343 T -> C LOC_Os10g06480.1 upstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:37.511; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1003331343 T -> C LOC_Os10g06470-LOC_Os10g06480 intergenic_region ; MODIFIER silent_mutation Average:37.511; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1003331343 T -> DEL N N silent_mutation Average:37.511; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003331343 NA 2.79E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 8.91E-06 mr1143 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 5.15E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 5.07E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 7.73E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 1.21E-06 2.85E-21 mr1698 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 2.36E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 2.44E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 4.70E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 1.12E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 4.53E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 2.13E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 4.65E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 1.13E-06 5.52E-19 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 4.36E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 2.73E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 2.20E-14 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 2.60E-10 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343 NA 5.77E-10 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251