Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003331343:

Variant ID: vg1003331343 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3331343
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCATCGTGGCCGTCTGCCATGGCCCGGCCGTGGATCTTGATCTCGGCCGTTCGTTTTGGATAGGATCGATCTCGGCCGTCCGTTCCCGTGAACCGCTGC[T/C]
GTGCGCCCGGTCCACCGCAAACCCTAGTTGCTGACGCAATAAACCCTTTTTCCTTTTCAAAAATAATTCGTTATTGCGTCATAATTCAATTAAAATCCAT

Reverse complement sequence

ATGGATTTTAATTGAATTATGACGCAATAACGAATTATTTTTGAAAAGGAAAAAGGGTTTATTGCGTCAGCAACTAGGGTTTGCGGTGGACCGGGCGCAC[A/G]
GCAGCGGTTCACGGGAACGGACGGCCGAGATCGATCCTATCCAAAACGAACGGCCGAGATCAAGATCCACGGCCGGGCCATGGCAGACGGCCACGATGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	38.70%	1.14%	0.28%	NA
All Indica	2759	78.10%	20.30%	1.27%	0.29%	NA
All Japonica	1512	20.10%	78.50%	1.06%	0.33%	NA
Aus	269	94.40%	5.20%	0.37%	0.00%	NA
Indica I	595	56.30%	41.50%	1.68%	0.50%	NA
Indica II	465	86.00%	12.50%	1.08%	0.43%	NA
Indica III	913	89.40%	9.60%	0.66%	0.33%	NA
Indica Intermediate	786	77.00%	21.20%	1.78%	0.00%	NA
Temperate Japonica	767	27.80%	72.20%	0.00%	0.00%	NA
Tropical Japonica	504	6.30%	89.50%	3.17%	0.99%	NA
Japonica Intermediate	241	24.50%	75.50%	0.00%	0.00%	NA
VI/Aromatic	96	71.90%	28.10%	0.00%	0.00%	NA
Intermediate	90	52.20%	45.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003331343	T -> C	LOC_Os10g06460.1	upstream_gene_variant ; 3637.0bp to feature; MODIFIER	silent_mutation	Average:37.511; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg1003331343	T -> C	LOC_Os10g06470.1	upstream_gene_variant ; 80.0bp to feature; MODIFIER	silent_mutation	Average:37.511; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg1003331343	T -> C	LOC_Os10g06480.1	upstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:37.511; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg1003331343	T -> C	LOC_Os10g06470-LOC_Os10g06480	intergenic_region ; MODIFIER	silent_mutation	Average:37.511; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg1003331343	T -> DEL	N	N	silent_mutation	Average:37.511; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003331343	NA	2.79E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	8.91E-06	mr1143	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	5.15E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	5.07E-10	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	7.73E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	1.21E-06	2.85E-21	mr1698	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	2.36E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	2.44E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	4.70E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	1.12E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	4.53E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	2.13E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	4.65E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	1.13E-06	5.52E-19	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	4.36E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	2.73E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	2.20E-14	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	2.60E-10	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003331343	NA	5.77E-10	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251