\
| Variant ID: vg1003305174 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3305174 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 82. )
GCGGTTGCCTTGGTCATTTGCAATGGCTTGCAGAAGTTGGGTTTGAGTGGCCATAACTCCGGCCAGGGTGGTTAGGTCAGGTGTCTGAGTTTCTTCATTG[T/C,G]
TGGTTGACGCCCGACGTCGGCTTGCCATCTGTGTAGGCCGATTAAGTAAGTATCCTAATTTTCTAACTAGCTCTTGTGGTTTTATCCCATTAAGGGAGTT
AACTCCCTTAATGGGATAAAACCACAAGAGCTAGTTAGAAAATTAGGATACTTACTTAATCGGCCTACACAGATGGCAAGCCGACGTCGGGCGTCAACCA[A/G,C]
CAATGAAGAAACTCAGACACCTGACCTAACCACCCTGGCCGGAGTTATGGCCACTCAAACCCAACTTCTGCAAGCCATTGCAAATGACCAAGGCAACCGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.30% | 33.40% | 9.31% | 16.97% | NA |
| All Indica | 2759 | 21.20% | 45.60% | 12.07% | 21.09% | NA |
| All Japonica | 1512 | 81.40% | 2.60% | 5.62% | 10.32% | NA |
| Aus | 269 | 4.80% | 90.30% | 1.86% | 2.97% | NA |
| Indica I | 595 | 42.90% | 16.10% | 12.77% | 28.24% | NA |
| Indica II | 465 | 14.40% | 57.40% | 10.54% | 17.63% | NA |
| Indica III | 913 | 9.00% | 62.70% | 11.72% | 16.65% | NA |
| Indica Intermediate | 786 | 23.20% | 41.10% | 12.85% | 22.90% | NA |
| Temperate Japonica | 767 | 75.50% | 3.30% | 6.39% | 14.86% | NA |
| Tropical Japonica | 504 | 89.50% | 2.40% | 5.56% | 2.58% | NA |
| Japonica Intermediate | 241 | 83.40% | 1.20% | 3.32% | 12.03% | NA |
| VI/Aromatic | 96 | 33.30% | 12.50% | 8.33% | 45.83% | NA |
| Intermediate | 90 | 47.80% | 28.90% | 10.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003305174 | T -> C | LOC_Os10g06430.1 | missense_variant ; p.Asn221Ser; MODERATE | nonsynonymous_codon | Average:9.525; most accessible tissue: Callus, score: 30.218 | benign |
-0.962 |
TOLERATED | 0.53 |
| vg1003305174 | T -> G | LOC_Os10g06430.1 | missense_variant ; p.Asn221Thr; MODERATE | N | Average:9.525; most accessible tissue: Callus, score: 30.218 | N | N | N | N |
| vg1003305174 | T -> DEL | LOC_Os10g06430.1 | N | frameshift_variant | Average:9.525; most accessible tissue: Callus, score: 30.218 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003305174 | NA | 9.80E-17 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 1.18E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 1.05E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 5.41E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 7.63E-10 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 7.62E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 2.82E-12 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 5.84E-19 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 1.88E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 7.05E-08 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 3.56E-06 | mr1585_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 7.52E-13 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 3.07E-16 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 4.13E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 1.84E-13 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 2.31E-10 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003305174 | NA | 1.50E-09 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |