Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003304680:

Variant ID: vg1003304680 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3304680
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

TTGATTAGGCTCCGGAAACTCTCATGATCTTGCCCAATCATAGGTCCACGCAACTCATCATTCAGCCCTTCTATGAACTTGTCGATCTTTTCTTCTTCAT[T/C]
TGCGAGGTCTCCAATTGCATAGCGGGCCAACTGAGTGAATCGGTTTAGATATTCCTGCACCGTTGTGTTCCCTTGTTGCAGCCTTCTAAACTCGTTCTTC

Reverse complement sequence

GAAGAACGAGTTTAGAAGGCTGCAACAAGGGAACACAACGGTGCAGGAATATCTAAACCGATTCACTCAGTTGGCCCGCTATGCAATTGGAGACCTCGCA[A/G]
ATGAAGAAGAAAAGATCGACAAGTTCATAGAAGGGCTGAATGATGAGTTGCGTGGACCTATGATTGGGCAAGATCATGAGAGTTTCCGGAGCCTAATCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.50%	0.50%	23.15%	31.78%	NA
All Indica	2759	26.60%	0.60%	28.71%	44.07%	NA
All Japonica	1512	82.90%	0.30%	4.03%	12.83%	NA
Aus	269	11.90%	0.40%	80.30%	7.43%	NA
Indica I	595	49.10%	0.20%	10.76%	40.00%	NA
Indica II	465	17.80%	1.70%	41.29%	39.14%	NA
Indica III	913	14.90%	0.20%	36.47%	48.41%	NA
Indica Intermediate	786	28.50%	0.60%	25.83%	45.04%	NA
Temperate Japonica	767	77.20%	0.40%	3.39%	19.04%	NA
Tropical Japonica	504	90.50%	0.20%	5.36%	3.97%	NA
Japonica Intermediate	241	85.10%	0.00%	3.32%	11.62%	NA
VI/Aromatic	96	37.50%	1.00%	8.33%	53.12%	NA
Intermediate	90	54.40%	3.30%	18.89%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003304680	T -> C	LOC_Os10g06430.1	missense_variant ; p.Asn386Asp; MODERATE	nonsynonymous_codon	Average:9.242; most accessible tissue: Callus, score: 41.938	possibly damaging	-1.641	TOLERATED	0.65
vg1003304680	T -> DEL	LOC_Os10g06430.1	N	frameshift_variant	Average:9.242; most accessible tissue: Callus, score: 41.938	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003304680	NA	2.70E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1003304680	NA	1.37E-18	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	4.09E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	1.14E-06	NA	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	8.09E-07	8.09E-07	mr1166	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	1.70E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	1.15E-06	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	9.35E-08	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	1.98E-11	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	1.02E-10	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	1.65E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	1.40E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	2.30E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	1.06E-10	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	3.33E-10	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	6.18E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	2.78E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	1.62E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	3.32E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	3.93E-07	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	2.45E-06	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	3.40E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	4.95E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	5.64E-06	1.51E-15	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	8.43E-09	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	8.85E-13	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	5.53E-09	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680	NA	8.94E-11	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251