\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003304680:

Variant ID: vg1003304680 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3304680
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATTAGGCTCCGGAAACTCTCATGATCTTGCCCAATCATAGGTCCACGCAACTCATCATTCAGCCCTTCTATGAACTTGTCGATCTTTTCTTCTTCAT[T/C]
TGCGAGGTCTCCAATTGCATAGCGGGCCAACTGAGTGAATCGGTTTAGATATTCCTGCACCGTTGTGTTCCCTTGTTGCAGCCTTCTAAACTCGTTCTTC

Reverse complement sequence

GAAGAACGAGTTTAGAAGGCTGCAACAAGGGAACACAACGGTGCAGGAATATCTAAACCGATTCACTCAGTTGGCCCGCTATGCAATTGGAGACCTCGCA[A/G]
ATGAAGAAGAAAAGATCGACAAGTTCATAGAAGGGCTGAATGATGAGTTGCGTGGACCTATGATTGGGCAAGATCATGAGAGTTTCCGGAGCCTAATCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.50% 0.50% 23.15% 31.78% NA
All Indica  2759 26.60% 0.60% 28.71% 44.07% NA
All Japonica  1512 82.90% 0.30% 4.03% 12.83% NA
Aus  269 11.90% 0.40% 80.30% 7.43% NA
Indica I  595 49.10% 0.20% 10.76% 40.00% NA
Indica II  465 17.80% 1.70% 41.29% 39.14% NA
Indica III  913 14.90% 0.20% 36.47% 48.41% NA
Indica Intermediate  786 28.50% 0.60% 25.83% 45.04% NA
Temperate Japonica  767 77.20% 0.40% 3.39% 19.04% NA
Tropical Japonica  504 90.50% 0.20% 5.36% 3.97% NA
Japonica Intermediate  241 85.10% 0.00% 3.32% 11.62% NA
VI/Aromatic  96 37.50% 1.00% 8.33% 53.12% NA
Intermediate  90 54.40% 3.30% 18.89% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003304680 T -> C LOC_Os10g06430.1 missense_variant ; p.Asn386Asp; MODERATE nonsynonymous_codon Average:9.242; most accessible tissue: Callus, score: 41.938 possibly damaging -1.641 TOLERATED 0.65
vg1003304680 T -> DEL LOC_Os10g06430.1 N frameshift_variant Average:9.242; most accessible tissue: Callus, score: 41.938 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003304680 NA 2.70E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1003304680 NA 1.37E-18 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 4.09E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 1.14E-06 NA mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 8.09E-07 8.09E-07 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 1.70E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 1.15E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 9.35E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 1.98E-11 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 1.02E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 1.65E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 1.40E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 2.30E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 1.06E-10 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 3.33E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 6.18E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 2.78E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 1.62E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 3.32E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 3.93E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 2.45E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 3.40E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 4.95E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 5.64E-06 1.51E-15 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 8.43E-09 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 8.85E-13 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 5.53E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003304680 NA 8.94E-11 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251