\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003300042:

Variant ID: vg1003300042 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3300042
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


AACAGAAGTAGGTAAGGCAGCGGAGTTAAGGCAGCGGCACGCCATTGCCACAGGCAACGACCGTAACTAAGACCTACTGAGCGCCATCGTCTTCATCACC[A/C]
TCCTGGTAGTAAGCATAGGGATCCTCCGAAGCTTCATCTCCGACCACTGATTAAGTTTGTATATTGCAAGGGTGAGTACCAATCGTACTCAACAAGCCAC

Reverse complement sequence

GTGGCTTGTTGAGTACGATTGGTACTCACCCTTGCAATATACAAACTTAATCAGTGGTCGGAGATGAAGCTTCGGAGGATCCCTATGCTTACTACCAGGA[T/G]
GGTGATGAAGACGATGGCGCTCAGTAGGTCTTAGTTACGGTCGTTGCCTGTGGCAATGGCGTGCCGCTGCCTTAACTCCGCTGCCTTACCTACTTCTGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.10% 17.50% 2.20% 40.18% NA
All Indica  2759 22.40% 10.30% 3.44% 63.86% NA
All Japonica  1512 77.50% 19.20% 0.53% 2.71% NA
Aus  269 6.70% 82.90% 0.00% 10.41% NA
Indica I  595 41.50% 3.00% 2.52% 52.94% NA
Indica II  465 14.40% 29.20% 3.44% 52.90% NA
Indica III  913 14.20% 4.80% 3.72% 77.22% NA
Indica Intermediate  786 22.00% 11.10% 3.82% 63.10% NA
Temperate Japonica  767 70.80% 28.60% 0.00% 0.65% NA
Tropical Japonica  504 88.50% 3.00% 1.59% 6.94% NA
Japonica Intermediate  241 75.90% 23.70% 0.00% 0.41% NA
VI/Aromatic  96 44.80% 10.40% 0.00% 44.79% NA
Intermediate  90 52.20% 18.90% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003300042 A -> C LOC_Os10g06410.1 upstream_gene_variant ; 3481.0bp to feature; MODIFIER silent_mutation Average:9.556; most accessible tissue: Callus, score: 42.841 N N N N
vg1003300042 A -> C LOC_Os10g06420.1 upstream_gene_variant ; 382.0bp to feature; MODIFIER silent_mutation Average:9.556; most accessible tissue: Callus, score: 42.841 N N N N
vg1003300042 A -> C LOC_Os10g06430.1 downstream_gene_variant ; 748.0bp to feature; MODIFIER silent_mutation Average:9.556; most accessible tissue: Callus, score: 42.841 N N N N
vg1003300042 A -> C LOC_Os10g06420-LOC_Os10g06430 intergenic_region ; MODIFIER silent_mutation Average:9.556; most accessible tissue: Callus, score: 42.841 N N N N
vg1003300042 A -> DEL N N silent_mutation Average:9.556; most accessible tissue: Callus, score: 42.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003300042 NA 1.34E-18 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 4.98E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 2.23E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 1.72E-13 mr1322 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 7.79E-07 mr1322 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 1.83E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 2.66E-12 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 7.17E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 3.83E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 6.52E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 4.80E-09 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 5.79E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 3.49E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 1.21E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 4.47E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 3.43E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 1.33E-13 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 1.34E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 1.01E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 1.33E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 4.51E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 3.78E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 4.59E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 3.53E-06 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 1.60E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 2.12E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 7.61E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 9.89E-12 1.73E-20 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 2.31E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 4.28E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 1.72E-13 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042 NA 9.01E-09 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251