Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003300042:

Variant ID: vg1003300042 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3300042
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:

AACAGAAGTAGGTAAGGCAGCGGAGTTAAGGCAGCGGCACGCCATTGCCACAGGCAACGACCGTAACTAAGACCTACTGAGCGCCATCGTCTTCATCACC[A/C]
TCCTGGTAGTAAGCATAGGGATCCTCCGAAGCTTCATCTCCGACCACTGATTAAGTTTGTATATTGCAAGGGTGAGTACCAATCGTACTCAACAAGCCAC

Reverse complement sequence

GTGGCTTGTTGAGTACGATTGGTACTCACCCTTGCAATATACAAACTTAATCAGTGGTCGGAGATGAAGCTTCGGAGGATCCCTATGCTTACTACCAGGA[T/G]
GGTGATGAAGACGATGGCGCTCAGTAGGTCTTAGTTACGGTCGTTGCCTGTGGCAATGGCGTGCCGCTGCCTTAACTCCGCTGCCTTACCTACTTCTGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.10%	17.50%	2.20%	40.18%	NA
All Indica	2759	22.40%	10.30%	3.44%	63.86%	NA
All Japonica	1512	77.50%	19.20%	0.53%	2.71%	NA
Aus	269	6.70%	82.90%	0.00%	10.41%	NA
Indica I	595	41.50%	3.00%	2.52%	52.94%	NA
Indica II	465	14.40%	29.20%	3.44%	52.90%	NA
Indica III	913	14.20%	4.80%	3.72%	77.22%	NA
Indica Intermediate	786	22.00%	11.10%	3.82%	63.10%	NA
Temperate Japonica	767	70.80%	28.60%	0.00%	0.65%	NA
Tropical Japonica	504	88.50%	3.00%	1.59%	6.94%	NA
Japonica Intermediate	241	75.90%	23.70%	0.00%	0.41%	NA
VI/Aromatic	96	44.80%	10.40%	0.00%	44.79%	NA
Intermediate	90	52.20%	18.90%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003300042	A -> C	LOC_Os10g06410.1	upstream_gene_variant ; 3481.0bp to feature; MODIFIER	silent_mutation	Average:9.556; most accessible tissue: Callus, score: 42.841	N	N	N	N
vg1003300042	A -> C	LOC_Os10g06420.1	upstream_gene_variant ; 382.0bp to feature; MODIFIER	silent_mutation	Average:9.556; most accessible tissue: Callus, score: 42.841	N	N	N	N
vg1003300042	A -> C	LOC_Os10g06430.1	downstream_gene_variant ; 748.0bp to feature; MODIFIER	silent_mutation	Average:9.556; most accessible tissue: Callus, score: 42.841	N	N	N	N
vg1003300042	A -> C	LOC_Os10g06420-LOC_Os10g06430	intergenic_region ; MODIFIER	silent_mutation	Average:9.556; most accessible tissue: Callus, score: 42.841	N	N	N	N
vg1003300042	A -> DEL	N	N	silent_mutation	Average:9.556; most accessible tissue: Callus, score: 42.841	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003300042	NA	1.34E-18	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	4.98E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	2.23E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	1.72E-13	mr1322	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	7.79E-07	mr1322	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	1.83E-15	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	2.66E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	7.17E-14	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	3.83E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	6.52E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	4.80E-09	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	5.79E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	3.49E-12	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	1.21E-10	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	4.47E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	3.43E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	1.33E-13	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	1.34E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	1.01E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	1.33E-06	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	4.51E-06	mr1922	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	3.78E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	4.59E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	3.53E-06	mr1173_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	1.60E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	2.12E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	7.61E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	9.89E-12	1.73E-20	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	2.31E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	4.28E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	1.72E-13	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003300042	NA	9.01E-09	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251