Search for Variation information by Variation ID:
Detailed information for vg1003299582:
| Variant ID: vg1003299582 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3299582 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CGAGTGGTCCGATTCGCCCACAGCACGGCGGGCAGTTCCTCGAGCCATGAATCCCCGTGCTTCTTCAGGACGTTGTACGTCTTGGTCTTGAGTCCTTTGA[A/G]
GATTTCGGCGTTGGCTCGCTCGACTTGGCCGTTGCTCTTGGGGTGGGTAGGCGAGGCAAAGCACAGCTTGATGCCCATGTCGTCGCAATAGTCGCCGAAA
Reverse complement sequence
TTTCGGCGACTATTGCGACGACATGGGCATCAAGCTGTGCTTTGCCTCGCCTACCCACCCCAAGAGCAACGGCCAAGTCGAGCGAGCCAACGCCGAAATC[T/C]
TCAAAGGACTCAAGACCAAGACGTACAACGTCCTGAAGAAGCACGGGGATTCATGGCTCGAGGAACTGCCCGCCGTGCTGTGGGCGAATCGGACCACTCG
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.90% | 27.80% | 2.20% | 30.11% | NA |
| All Indica | 2759 | 21.90% | 24.70% | 3.70% | 49.69% | NA |
| All Japonica | 1512 | 77.60% | 21.30% | 0.00% | 1.12% | NA |
| Aus | 269 | 6.70% | 91.40% | 0.37% | 1.49% | NA |
| Indica I | 595 | 41.50% | 17.80% | 2.69% | 37.98% | NA |
| Indica II | 465 | 14.80% | 38.90% | 4.95% | 41.29% | NA |
| Indica III | 913 | 13.30% | 22.30% | 4.71% | 59.69% | NA |
| Indica Intermediate | 786 | 21.40% | 24.20% | 2.54% | 51.91% | NA |
| Temperate Japonica | 767 | 70.90% | 28.60% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 88.30% | 9.10% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 76.30% | 23.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 39.60% | 0.00% | 15.62% | NA |
| Intermediate | 90 | 53.30% | 27.80% | 1.11% | 17.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003299582 | A -> G | LOC_Os10g06420.1 | missense_variant ; p.Phe27Leu; MODERATE | nonsynonymous_codon ; F27L | Average:18.793; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | possibly damaging  |
-1.609 |
TOLERATED | 1.00 |
| vg1003299582 | A -> DEL | LOC_Os10g06420.1 | N | frameshift_variant | Average:18.793; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003299582 | NA | 4.98E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003299582 | NA | 2.23E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003299582 | 1.90E-06 | 1.90E-06 | mr1355 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003299582 | NA | 4.47E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003299582 | NA | 3.43E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003299582 | NA | 8.56E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003299582 | NA | 4.51E-06 | mr1922 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003299582 | NA | 4.59E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003299582 | NA | 6.21E-09 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003299582 | 9.89E-12 | 1.73E-20 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |