\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003223593:

Variant ID: vg1003223593 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3223593
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCTTGGAGGATTTTTGTATATTTCCTAAAAGCCTAAAACGTGTAAATAAATTTTAGTGGAATTTTCAGAGCACAAATAATAATTGAAAAGAAATAAACA[T/A]
AGTTAAAAAGGTTTATAAAAAGAAAATCTTAAAAGAAGTTCTTTTCCCCCCCTTTTCTCTTCTTGGGCCGGCTCGGCCCAATCCCTCCCTCTCTCTCTCT

Reverse complement sequence

AGAGAGAGAGAGGGAGGGATTGGGCCGAGCCGGCCCAAGAAGAGAAAAGGGGGGGAAAAGAACTTCTTTTAAGATTTTCTTTTTATAAACCTTTTTAACT[A/T]
TGTTTATTTCTTTTCAATTATTATTTGTGCTCTGAAAATTCCACTAAAATTTATTTACACGTTTTAGGCTTTTAGGAAATATACAAAAATCCTCCAAGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.80% 8.40% 17.33% 38.47% NA
All Indica  2759 13.70% 6.10% 23.56% 56.65% NA
All Japonica  1512 81.20% 0.50% 5.95% 12.30% NA
Aus  269 5.90% 68.00% 20.07% 5.95% NA
Indica I  595 26.40% 6.20% 13.11% 54.29% NA
Indica II  465 6.50% 2.20% 16.99% 74.41% NA
Indica III  913 10.10% 7.10% 36.04% 46.77% NA
Indica Intermediate  786 12.70% 7.00% 20.87% 59.41% NA
Temperate Japonica  767 77.80% 0.00% 7.17% 14.99% NA
Tropical Japonica  504 88.10% 0.60% 2.18% 9.13% NA
Japonica Intermediate  241 77.60% 2.10% 9.96% 10.37% NA
VI/Aromatic  96 28.10% 33.30% 11.46% 27.08% NA
Intermediate  90 47.80% 6.70% 15.56% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003223593 T -> A LOC_Os10g06280.1 upstream_gene_variant ; 710.0bp to feature; MODIFIER silent_mutation Average:35.234; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N
vg1003223593 T -> A LOC_Os10g06290.1 upstream_gene_variant ; 1960.0bp to feature; MODIFIER silent_mutation Average:35.234; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N
vg1003223593 T -> A LOC_Os10g06270.1 downstream_gene_variant ; 4774.0bp to feature; MODIFIER silent_mutation Average:35.234; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N
vg1003223593 T -> A LOC_Os10g06280-LOC_Os10g06290 intergenic_region ; MODIFIER silent_mutation Average:35.234; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N
vg1003223593 T -> DEL N N silent_mutation Average:35.234; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003223593 NA 8.41E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 2.88E-06 NA mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 7.59E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 1.88E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 1.01E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 5.32E-11 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 2.18E-06 NA mr1515 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 4.11E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 7.74E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 2.44E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 1.97E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 3.04E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 2.00E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 6.08E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 1.41E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 3.11E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 1.45E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 7.13E-14 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 9.54E-06 mr1940 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 1.03E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 2.45E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 6.86E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 2.69E-06 mr1227_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 1.30E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 1.44E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 6.71E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 2.30E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 1.59E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 6.69E-14 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 3.84E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 3.20E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 1.14E-14 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 4.03E-11 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003223593 NA 7.14E-11 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251