Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003193153:

Variant ID: vg1003193153 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3193153
Reference Allele: T	Alternative Allele: A,G
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGTTGGGTTATTTCTGGTCGTGACAAGTTGGTATCAGAGCCCCCTTGACCCTAGGACGAGCTTTAGATCCCAAGCCTTAGCAATATTTTCGAAATAAAA[T/A,G]
TCCTTTCTTATTTGTGAAAATCCTCTAGTCTCTCTCTGTCCCGCTGCTTCATTTATCGTCAAAATCTGATCTTTAAAATGTTGCTATTCTCTTTTGTTTT

Reverse complement sequence

AAAACAAAAGAGAATAGCAACATTTTAAAGATCAGATTTTGACGATAAATGAAGCAGCGGGACAGAGAGAGACTAGAGGATTTTCACAAATAAGAAAGGA[A/T,C]
TTTTATTTCGAAAATATTGCTAAGGCTTGGGATCTAAAGCTCGTCCTAGGGTCAAGGGGGCTCTGATACCAACTTGTCACGACCAGAAATAACCCAACGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	37.30%	12.78%	0.21%	G: 0.02%
All Indica	2759	82.70%	8.30%	8.70%	0.29%	G: 0.04%
All Japonica	1512	1.10%	96.00%	2.98%	0.00%	NA
Aus	269	6.30%	5.90%	87.73%	0.00%	NA
Indica I	595	86.70%	9.70%	2.52%	1.01%	NA
Indica II	465	79.40%	3.40%	17.20%	0.00%	NA
Indica III	913	82.00%	10.70%	7.12%	0.11%	NA
Indica Intermediate	786	82.40%	7.10%	10.18%	0.13%	G: 0.13%
Temperate Japonica	767	0.50%	99.20%	0.26%	0.00%	NA
Tropical Japonica	504	2.20%	89.90%	7.94%	0.00%	NA
Japonica Intermediate	241	0.40%	98.30%	1.24%	0.00%	NA
VI/Aromatic	96	7.30%	32.30%	59.38%	1.04%	NA
Intermediate	90	28.90%	41.10%	28.89%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003193153	T -> G	LOC_Os10g06210.1	upstream_gene_variant ; 3411.0bp to feature; MODIFIER	silent_mutation	Average:12.368; most accessible tissue: Callus, score: 27.457	N	N	N	N
vg1003193153	T -> G	LOC_Os10g06230.1	upstream_gene_variant ; 1168.0bp to feature; MODIFIER	silent_mutation	Average:12.368; most accessible tissue: Callus, score: 27.457	N	N	N	N
vg1003193153	T -> G	LOC_Os10g06220.1	intron_variant ; MODIFIER	silent_mutation	Average:12.368; most accessible tissue: Callus, score: 27.457	N	N	N	N
vg1003193153	T -> A	LOC_Os10g06210.1	upstream_gene_variant ; 3411.0bp to feature; MODIFIER	silent_mutation	Average:12.368; most accessible tissue: Callus, score: 27.457	N	N	N	N
vg1003193153	T -> A	LOC_Os10g06230.1	upstream_gene_variant ; 1168.0bp to feature; MODIFIER	silent_mutation	Average:12.368; most accessible tissue: Callus, score: 27.457	N	N	N	N
vg1003193153	T -> A	LOC_Os10g06220.1	intron_variant ; MODIFIER	silent_mutation	Average:12.368; most accessible tissue: Callus, score: 27.457	N	N	N	N
vg1003193153	T -> DEL	N	N	silent_mutation	Average:12.368; most accessible tissue: Callus, score: 27.457	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003193153	NA	1.75E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003193153	NA	2.29E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003193153	5.34E-07	4.03E-07	mr1768	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003193153	NA	1.11E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003193153	NA	2.74E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003193153	NA	2.38E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251