\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003192650:

Variant ID: vg1003192650 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3192650
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


GCCACTTCGGTCTGAATCATCGTAGGCCTTGGGTTAAGGCAGGTTCGTGTGGGTTCACGGCCCTTATTAATAATCTGGTATAGCTCTAGGATCGTATTTA[T/C]
AAAATAGCTTTGAGCAACTAAGTGTCTTTTAATGCTGTTTACTGCAAATCCTAACCCTTATATTATAACCCCCTTGTACTCCCTTGCATTTATTCTGCAC

Reverse complement sequence

GTGCAGAATAAATGCAAGGGAGTACAAGGGGGTTATAATATAAGGGTTAGGATTTGCAGTAAACAGCATTAAAAGACACTTAGTTGCTCAAAGCTATTTT[A/G]
TAAATACGATCCTAGAGCTATACCAGATTATTAATAAGGGCCGTGAACCCACACGAACCTGCCTTAACCCAAGGCCTACGATGATTCAGACCGAAGTGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.70% 6.90% 31.70% 31.68% NA
All Indica  2759 7.90% 1.20% 41.39% 49.51% NA
All Japonica  1512 73.70% 18.50% 5.62% 2.25% NA
Aus  269 4.50% 1.50% 84.01% 10.04% NA
Indica I  595 8.70% 1.80% 33.11% 56.30% NA
Indica II  465 3.00% 0.60% 60.22% 36.13% NA
Indica III  913 10.60% 1.20% 29.46% 58.71% NA
Indica Intermediate  786 7.00% 1.00% 50.38% 41.60% NA
Temperate Japonica  767 64.40% 28.20% 7.17% 0.26% NA
Tropical Japonica  504 87.90% 1.80% 4.17% 6.15% NA
Japonica Intermediate  241 73.40% 22.40% 3.73% 0.41% NA
VI/Aromatic  96 26.00% 7.30% 16.67% 50.00% NA
Intermediate  90 38.90% 4.40% 32.22% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003192650 T -> C LOC_Os10g06210.1 upstream_gene_variant ; 2908.0bp to feature; MODIFIER silent_mutation Average:9.353; most accessible tissue: Zhenshan97 flower, score: 15.748 N N N N
vg1003192650 T -> C LOC_Os10g06230.1 upstream_gene_variant ; 1671.0bp to feature; MODIFIER silent_mutation Average:9.353; most accessible tissue: Zhenshan97 flower, score: 15.748 N N N N
vg1003192650 T -> C LOC_Os10g06220.1 intron_variant ; MODIFIER silent_mutation Average:9.353; most accessible tissue: Zhenshan97 flower, score: 15.748 N N N N
vg1003192650 T -> DEL N N silent_mutation Average:9.353; most accessible tissue: Zhenshan97 flower, score: 15.748 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003192650 NA 5.79E-17 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 3.06E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 6.20E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 4.09E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 1.13E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 6.76E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 1.34E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 2.24E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 4.10E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 5.70E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 2.43E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 5.82E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 6.63E-12 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 3.37E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 7.34E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 7.48E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 1.76E-17 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 8.95E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 6.55E-06 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 3.89E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 2.56E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 3.95E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 6.99E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 1.20E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 5.06E-08 4.56E-09 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 2.40E-11 4.03E-18 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 5.25E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 1.31E-09 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 7.74E-16 mr1761_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 2.90E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 5.09E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 1.67E-10 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003192650 NA 5.84E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251