\
| Variant ID: vg1003189276 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3189276 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, A: 0.41, others allele: 0.00, population size: 42. )
GTGGCTGGAGGGGATCTCCTCCATCGCCTTAGCCAGTTCCGTGAGCGACGATGTCAGCAACCACTCGTCGGGATGCGCTGGGATCGAAGTTGTGACACCG[A/C]
ACTCCCCGGCGAGTTGGTGCACGCCGGTGAACGATGTCCGCAGCGAACCTCGGATGGCTGTCAGATGGCCCTCGAGCTCCGACATACGGTGCTCGAGTCC
GGACTCGAGCACCGTATGTCGGAGCTCGAGGGCCATCTGACAGCCATCCGAGGTTCGCTGCGGACATCGTTCACCGGCGTGCACCAACTCGCCGGGGAGT[T/G]
CGGTGTCACAACTTCGATCCCAGCGCATCCCGACGAGTGGTTGCTGACATCGTCGCTCACGGAACTGGCTAAGGCGATGGAGGAGATCCCCTCCAGCCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.30% | 36.50% | 0.51% | 21.63% | NA |
| All Indica | 2759 | 56.30% | 7.20% | 0.76% | 35.74% | NA |
| All Japonica | 1512 | 3.80% | 95.90% | 0.07% | 0.26% | NA |
| Aus | 269 | 92.90% | 4.10% | 0.00% | 2.97% | NA |
| Indica I | 595 | 51.10% | 8.10% | 1.68% | 39.16% | NA |
| Indica II | 465 | 74.00% | 1.90% | 0.86% | 23.23% | NA |
| Indica III | 913 | 42.50% | 10.10% | 0.22% | 47.21% | NA |
| Indica Intermediate | 786 | 65.90% | 6.20% | 0.64% | 27.23% | NA |
| Temperate Japonica | 767 | 0.40% | 99.20% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 10.10% | 89.70% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 53.10% | 31.20% | 0.00% | 15.62% | NA |
| Intermediate | 90 | 46.70% | 41.10% | 2.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003189276 | A -> C | LOC_Os10g06200.1 | upstream_gene_variant ; 4179.0bp to feature; MODIFIER | silent_mutation | Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1003189276 | A -> C | LOC_Os10g06220.1 | upstream_gene_variant ; 2921.0bp to feature; MODIFIER | silent_mutation | Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1003189276 | A -> C | LOC_Os10g06210.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg1003189276 | A -> DEL | N | N | silent_mutation | Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003189276 | NA | 1.53E-07 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003189276 | 5.99E-08 | 6.90E-11 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003189276 | 3.35E-07 | 8.83E-13 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003189276 | NA | 3.82E-07 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003189276 | 5.57E-06 | NA | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003189276 | 2.16E-06 | 2.36E-10 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003189276 | 9.62E-11 | 9.84E-16 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003189276 | 9.79E-08 | 1.70E-19 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |