\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003189276:

Variant ID: vg1003189276 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3189276
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, A: 0.41, others allele: 0.00, population size: 42. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGCTGGAGGGGATCTCCTCCATCGCCTTAGCCAGTTCCGTGAGCGACGATGTCAGCAACCACTCGTCGGGATGCGCTGGGATCGAAGTTGTGACACCG[A/C]
ACTCCCCGGCGAGTTGGTGCACGCCGGTGAACGATGTCCGCAGCGAACCTCGGATGGCTGTCAGATGGCCCTCGAGCTCCGACATACGGTGCTCGAGTCC

Reverse complement sequence

GGACTCGAGCACCGTATGTCGGAGCTCGAGGGCCATCTGACAGCCATCCGAGGTTCGCTGCGGACATCGTTCACCGGCGTGCACCAACTCGCCGGGGAGT[T/G]
CGGTGTCACAACTTCGATCCCAGCGCATCCCGACGAGTGGTTGCTGACATCGTCGCTCACGGAACTGGCTAAGGCGATGGAGGAGATCCCCTCCAGCCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.30% 36.50% 0.51% 21.63% NA
All Indica  2759 56.30% 7.20% 0.76% 35.74% NA
All Japonica  1512 3.80% 95.90% 0.07% 0.26% NA
Aus  269 92.90% 4.10% 0.00% 2.97% NA
Indica I  595 51.10% 8.10% 1.68% 39.16% NA
Indica II  465 74.00% 1.90% 0.86% 23.23% NA
Indica III  913 42.50% 10.10% 0.22% 47.21% NA
Indica Intermediate  786 65.90% 6.20% 0.64% 27.23% NA
Temperate Japonica  767 0.40% 99.20% 0.13% 0.26% NA
Tropical Japonica  504 10.10% 89.70% 0.00% 0.20% NA
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.41% NA
VI/Aromatic  96 53.10% 31.20% 0.00% 15.62% NA
Intermediate  90 46.70% 41.10% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003189276 A -> C LOC_Os10g06200.1 upstream_gene_variant ; 4179.0bp to feature; MODIFIER silent_mutation Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg1003189276 A -> C LOC_Os10g06220.1 upstream_gene_variant ; 2921.0bp to feature; MODIFIER silent_mutation Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg1003189276 A -> C LOC_Os10g06210.1 intron_variant ; MODIFIER silent_mutation Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg1003189276 A -> DEL N N silent_mutation Average:31.438; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003189276 NA 1.53E-07 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276 5.99E-08 6.90E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276 3.35E-07 8.83E-13 mr1709 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276 NA 3.82E-07 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276 5.57E-06 NA mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276 2.16E-06 2.36E-10 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276 9.62E-11 9.84E-16 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003189276 9.79E-08 1.70E-19 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251