Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003178529:

Variant ID: vg1003178529 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3178529
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAAATAAAACAAATTTGAAGAACCAAGAGGTGATGGTTAATGTATGCATGCCTTATATCATGAGACGTGGGAAAAAAGTGGTTGTGCCTTATATTTT[T/G,A]
GGTAGAGGGAGTATGAATGAAGACTCATTTTATTTGATAAATTTTATTGTGAACAACTAATGTTATATTAATATTGGCATGCACAATATATCGCTGTAAC

Reverse complement sequence

GTTACAGCGATATATTGTGCATGCCAATATTAATATAACATTAGTTGTTCACAATAAAATTTATCAAATAAAATGAGTCTTCATTCATACTCCCTCTACC[A/C,T]
AAAATATAAGGCACAACCACTTTTTTCCCACGTCTCATGATATAAGGCATGCATACATTAACCATCACCTCTTGGTTCTTCAAATTTGTTTTATTTTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.10% 28.40% 0.49% 32.99% A: 0.04%
All Indica  2759 41.90% 6.00% 0.80% 51.25% A: 0.07%
All Japonica  1512 23.90% 73.50% 0.07% 2.51% NA
Aus  269 84.40% 3.70% 0.00% 11.90% NA
Indica I  595 35.50% 4.40% 1.01% 59.16% NA
Indica II  465 60.60% 1.90% 0.43% 36.77% A: 0.22%
Indica III  913 27.70% 10.20% 0.66% 61.45% NA
Indica Intermediate  786 52.20% 4.70% 1.02% 41.98% A: 0.13%
Temperate Japonica  767 35.70% 63.90% 0.13% 0.26% NA
Tropical Japonica  504 5.60% 87.70% 0.00% 6.75% NA
Japonica Intermediate  241 24.90% 74.30% 0.00% 0.83% NA
VI/Aromatic  96 21.90% 24.00% 0.00% 54.17% NA
Intermediate  90 37.80% 36.70% 0.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003178529 T -> G LOC_Os10g06200.1 intron_variant ; MODIFIER silent_mutation Average:11.401; most accessible tissue: Callus, score: 44.338 N N N N
vg1003178529 T -> A LOC_Os10g06200.1 intron_variant ; MODIFIER silent_mutation Average:11.401; most accessible tissue: Callus, score: 44.338 N N N N
vg1003178529 T -> DEL N N silent_mutation Average:11.401; most accessible tissue: Callus, score: 44.338 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003178529 NA 1.40E-18 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 4.50E-06 NA mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 5.73E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.94E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 6.10E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 1.19E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 3.40E-12 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 7.56E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 1.99E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.53E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.05E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 1.95E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 1.34E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.60E-08 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.22E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 1.63E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 3.24E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 4.55E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 9.11E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 1.08E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 7.26E-13 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 8.88E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.99E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.03E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.50E-13 mr1940 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 6.66E-10 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.58E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 1.96E-17 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 8.97E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 3.55E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 1.94E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 1.87E-10 1.89E-19 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 1.32E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.26E-14 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 3.16E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 2.56E-10 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529 NA 1.39E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251