Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003178529:

Variant ID: vg1003178529 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3178529
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAAAATAAAACAAATTTGAAGAACCAAGAGGTGATGGTTAATGTATGCATGCCTTATATCATGAGACGTGGGAAAAAAGTGGTTGTGCCTTATATTTT[T/G,A]
GGTAGAGGGAGTATGAATGAAGACTCATTTTATTTGATAAATTTTATTGTGAACAACTAATGTTATATTAATATTGGCATGCACAATATATCGCTGTAAC

Reverse complement sequence

GTTACAGCGATATATTGTGCATGCCAATATTAATATAACATTAGTTGTTCACAATAAAATTTATCAAATAAAATGAGTCTTCATTCATACTCCCTCTACC[A/C,T]
AAAATATAAGGCACAACCACTTTTTTCCCACGTCTCATGATATAAGGCATGCATACATTAACCATCACCTCTTGGTTCTTCAAATTTGTTTTATTTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.10%	28.40%	0.49%	32.99%	A: 0.04%
All Indica	2759	41.90%	6.00%	0.80%	51.25%	A: 0.07%
All Japonica	1512	23.90%	73.50%	0.07%	2.51%	NA
Aus	269	84.40%	3.70%	0.00%	11.90%	NA
Indica I	595	35.50%	4.40%	1.01%	59.16%	NA
Indica II	465	60.60%	1.90%	0.43%	36.77%	A: 0.22%
Indica III	913	27.70%	10.20%	0.66%	61.45%	NA
Indica Intermediate	786	52.20%	4.70%	1.02%	41.98%	A: 0.13%
Temperate Japonica	767	35.70%	63.90%	0.13%	0.26%	NA
Tropical Japonica	504	5.60%	87.70%	0.00%	6.75%	NA
Japonica Intermediate	241	24.90%	74.30%	0.00%	0.83%	NA
VI/Aromatic	96	21.90%	24.00%	0.00%	54.17%	NA
Intermediate	90	37.80%	36.70%	0.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003178529	T -> G	LOC_Os10g06200.1	intron_variant ; MODIFIER	silent_mutation	Average:11.401; most accessible tissue: Callus, score: 44.338	N	N	N	N
vg1003178529	T -> A	LOC_Os10g06200.1	intron_variant ; MODIFIER	silent_mutation	Average:11.401; most accessible tissue: Callus, score: 44.338	N	N	N	N
vg1003178529	T -> DEL	N	N	silent_mutation	Average:11.401; most accessible tissue: Callus, score: 44.338	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003178529	NA	1.40E-18	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	4.50E-06	NA	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	5.73E-06	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.94E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	6.10E-06	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	1.19E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	3.40E-12	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	7.56E-16	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	1.99E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.53E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.05E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	1.95E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	1.34E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.60E-08	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.22E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	1.63E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	3.24E-10	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	4.55E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	9.11E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	1.08E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	7.26E-13	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	8.88E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.99E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.03E-06	mr1922	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.50E-13	mr1940	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	6.66E-10	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.58E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	1.96E-17	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	8.97E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	3.55E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	1.94E-13	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	1.87E-10	1.89E-19	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	1.32E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.26E-14	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	3.16E-09	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	2.56E-10	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003178529	NA	1.39E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251