\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003175110:

Variant ID: vg1003175110 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3175110
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTAATCAAATTATTACGAGTTATAACATCATTTATTATGGTGAGAAGTGTGAGACTAATCACGAAAGACATTGTTAGACCTGCCCATAACCGCGGGCAC[A/G]
ACTATTCGAATAGTTTTACTCTGGCCAGAGGTGTACCACTGTACCCATAAGACACAGCCCCACAACATGTCACCATGTGCCTCAATACCACCACGGTACC

Reverse complement sequence

GGTACCGTGGTGGTATTGAGGCACATGGTGACATGTTGTGGGGCTGTGTCTTATGGGTACAGTGGTACACCTCTGGCCAGAGTAAAACTATTCGAATAGT[T/C]
GTGCCCGCGGTTATGGGCAGGTCTAACAATGTCTTTCGTGATTAGTCTCACACTTCTCACCATAATAAATGATGTTATAACTCGTAATAATTTGATTAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.10% 16.00% 21.31% 33.60% NA
All Indica  2759 19.30% 4.20% 28.09% 48.46% NA
All Japonica  1512 35.80% 38.90% 12.30% 12.96% NA
Aus  269 92.60% 3.00% 2.23% 2.23% NA
Indica I  595 9.60% 1.30% 35.80% 53.28% NA
Indica II  465 38.90% 0.40% 21.72% 38.92% NA
Indica III  913 14.50% 9.40% 23.77% 52.35% NA
Indica Intermediate  786 20.60% 2.40% 31.04% 45.93% NA
Temperate Japonica  767 53.30% 12.60% 16.17% 17.86% NA
Tropical Japonica  504 11.50% 77.20% 4.17% 7.14% NA
Japonica Intermediate  241 31.10% 42.30% 17.01% 9.54% NA
VI/Aromatic  96 18.80% 25.00% 28.12% 28.12% NA
Intermediate  90 40.00% 21.10% 14.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003175110 A -> G LOC_Os10g06190.1 downstream_gene_variant ; 3457.0bp to feature; MODIFIER silent_mutation Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg1003175110 A -> G LOC_Os10g06200.1 downstream_gene_variant ; 2720.0bp to feature; MODIFIER silent_mutation Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg1003175110 A -> G LOC_Os10g06190-LOC_Os10g06200 intergenic_region ; MODIFIER silent_mutation Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N
vg1003175110 A -> DEL N N silent_mutation Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003175110 NA 7.99E-06 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 4.19E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 3.04E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 2.06E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 2.51E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 4.73E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 5.80E-08 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 8.66E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 2.24E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 1.51E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 3.13E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 4.81E-08 mr1328 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 4.28E-10 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 9.13E-06 mr1363 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 4.88E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 3.39E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 8.03E-07 mr1428 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 7.72E-07 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 1.70E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 1.87E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 2.68E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 7.06E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 1.45E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 3.59E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 2.26E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 3.56E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 1.91E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 6.63E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 1.47E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 1.70E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 8.97E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 4.89E-06 NA mr1780 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 4.32E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 8.30E-06 5.33E-08 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 2.53E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 7.13E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 1.88E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 9.87E-06 4.53E-07 mr1991 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110 NA 9.11E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251