Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003175110:

Variant ID: vg1003175110 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3175110
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTAATCAAATTATTACGAGTTATAACATCATTTATTATGGTGAGAAGTGTGAGACTAATCACGAAAGACATTGTTAGACCTGCCCATAACCGCGGGCAC[A/G]
ACTATTCGAATAGTTTTACTCTGGCCAGAGGTGTACCACTGTACCCATAAGACACAGCCCCACAACATGTCACCATGTGCCTCAATACCACCACGGTACC

Reverse complement sequence

GGTACCGTGGTGGTATTGAGGCACATGGTGACATGTTGTGGGGCTGTGTCTTATGGGTACAGTGGTACACCTCTGGCCAGAGTAAAACTATTCGAATAGT[T/C]
GTGCCCGCGGTTATGGGCAGGTCTAACAATGTCTTTCGTGATTAGTCTCACACTTCTCACCATAATAAATGATGTTATAACTCGTAATAATTTGATTAGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.10%	16.00%	21.31%	33.60%	NA
All Indica	2759	19.30%	4.20%	28.09%	48.46%	NA
All Japonica	1512	35.80%	38.90%	12.30%	12.96%	NA
Aus	269	92.60%	3.00%	2.23%	2.23%	NA
Indica I	595	9.60%	1.30%	35.80%	53.28%	NA
Indica II	465	38.90%	0.40%	21.72%	38.92%	NA
Indica III	913	14.50%	9.40%	23.77%	52.35%	NA
Indica Intermediate	786	20.60%	2.40%	31.04%	45.93%	NA
Temperate Japonica	767	53.30%	12.60%	16.17%	17.86%	NA
Tropical Japonica	504	11.50%	77.20%	4.17%	7.14%	NA
Japonica Intermediate	241	31.10%	42.30%	17.01%	9.54%	NA
VI/Aromatic	96	18.80%	25.00%	28.12%	28.12%	NA
Intermediate	90	40.00%	21.10%	14.44%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003175110	A -> G	LOC_Os10g06190.1	downstream_gene_variant ; 3457.0bp to feature; MODIFIER	silent_mutation	Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg1003175110	A -> G	LOC_Os10g06200.1	downstream_gene_variant ; 2720.0bp to feature; MODIFIER	silent_mutation	Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg1003175110	A -> G	LOC_Os10g06190-LOC_Os10g06200	intergenic_region ; MODIFIER	silent_mutation	Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg1003175110	A -> DEL	N	N	silent_mutation	Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003175110	NA	7.99E-06	mr1042	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	4.19E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	3.04E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	2.06E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	2.51E-06	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	4.73E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	5.80E-08	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	8.66E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	2.24E-07	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	1.51E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	3.13E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	4.81E-08	mr1328	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	4.28E-10	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	9.13E-06	mr1363	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	4.88E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	3.39E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	8.03E-07	mr1428	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	7.72E-07	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	1.70E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	1.87E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	2.68E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	7.06E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	1.45E-09	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	3.59E-06	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	2.26E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	3.56E-08	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	1.91E-08	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	6.63E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	1.47E-07	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	1.70E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	8.97E-06	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	4.89E-06	NA	mr1780	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	4.32E-07	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	8.30E-06	5.33E-08	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	2.53E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	7.13E-11	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	1.88E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	9.87E-06	4.53E-07	mr1991	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003175110	NA	9.11E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251