| Variant ID: vg1003175110 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3175110 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCTAATCAAATTATTACGAGTTATAACATCATTTATTATGGTGAGAAGTGTGAGACTAATCACGAAAGACATTGTTAGACCTGCCCATAACCGCGGGCAC[A/G]
ACTATTCGAATAGTTTTACTCTGGCCAGAGGTGTACCACTGTACCCATAAGACACAGCCCCACAACATGTCACCATGTGCCTCAATACCACCACGGTACC
GGTACCGTGGTGGTATTGAGGCACATGGTGACATGTTGTGGGGCTGTGTCTTATGGGTACAGTGGTACACCTCTGGCCAGAGTAAAACTATTCGAATAGT[T/C]
GTGCCCGCGGTTATGGGCAGGTCTAACAATGTCTTTCGTGATTAGTCTCACACTTCTCACCATAATAAATGATGTTATAACTCGTAATAATTTGATTAGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.10% | 16.00% | 21.31% | 33.60% | NA |
| All Indica | 2759 | 19.30% | 4.20% | 28.09% | 48.46% | NA |
| All Japonica | 1512 | 35.80% | 38.90% | 12.30% | 12.96% | NA |
| Aus | 269 | 92.60% | 3.00% | 2.23% | 2.23% | NA |
| Indica I | 595 | 9.60% | 1.30% | 35.80% | 53.28% | NA |
| Indica II | 465 | 38.90% | 0.40% | 21.72% | 38.92% | NA |
| Indica III | 913 | 14.50% | 9.40% | 23.77% | 52.35% | NA |
| Indica Intermediate | 786 | 20.60% | 2.40% | 31.04% | 45.93% | NA |
| Temperate Japonica | 767 | 53.30% | 12.60% | 16.17% | 17.86% | NA |
| Tropical Japonica | 504 | 11.50% | 77.20% | 4.17% | 7.14% | NA |
| Japonica Intermediate | 241 | 31.10% | 42.30% | 17.01% | 9.54% | NA |
| VI/Aromatic | 96 | 18.80% | 25.00% | 28.12% | 28.12% | NA |
| Intermediate | 90 | 40.00% | 21.10% | 14.44% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003175110 | A -> G | LOC_Os10g06190.1 | downstream_gene_variant ; 3457.0bp to feature; MODIFIER | silent_mutation | Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888 | N | N | N | N |
| vg1003175110 | A -> G | LOC_Os10g06200.1 | downstream_gene_variant ; 2720.0bp to feature; MODIFIER | silent_mutation | Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888 | N | N | N | N |
| vg1003175110 | A -> G | LOC_Os10g06190-LOC_Os10g06200 | intergenic_region ; MODIFIER | silent_mutation | Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888 | N | N | N | N |
| vg1003175110 | A -> DEL | N | N | silent_mutation | Average:12.711; most accessible tissue: Zhenshan97 root, score: 23.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003175110 | NA | 7.99E-06 | mr1042 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003175110 | NA | 4.19E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003175110 | NA | 3.04E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003175110 | NA | 2.06E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003175110 | NA | 2.51E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003175110 | NA | 4.73E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003175110 | NA | 5.80E-08 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003175110 | NA | 8.66E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003175110 | NA | 2.24E-07 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003175110 | NA | 1.51E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/