RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1003133816:

Variant ID: vg1003133816 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3133816
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.28, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TACTCTCCCTCCTCTCTATCCATGCATGGATGCATGAATTCAAAATGAATTTTCTCCTAAACTACTTATCTAATATACTATCCGATAACACTCTTATATT[C/T]
GTTGTAATTAAATCTTCACGACAAGATATGGCGTGATTATGTTCTGATGTAAAAAAACATATGTTTTAGTCCGTTAATACTTAATGTTTCATAGCAACAT

Reverse complement sequence

ATGTTGCTATGAAACATTAAGTATTAACGGACTAAAACATATGTTTTTTTACATCAGAACATAATCACGCCATATCTTGTCGTGAAGATTTAATTACAAC[G/A]
AATATAAGAGTGTTATCGGATAGTATATTAGATAAGTAGTTTAGGAGAAAATTCATTTTGAATTCATGCATCCATGCATGGATAGAGAGGAGGGAGAGTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	12.00%	0.47%	7.30%	NA
All Indica	2759	83.30%	16.10%	0.22%	0.33%	NA
All Japonica	1512	74.90%	2.40%	0.99%	21.63%	NA
Aus	269	91.40%	8.60%	0.00%	0.00%	NA
Indica I	595	80.70%	18.20%	0.00%	1.18%	NA
Indica II	465	86.70%	12.90%	0.43%	0.00%	NA
Indica III	913	81.80%	18.00%	0.22%	0.00%	NA
Indica Intermediate	786	85.10%	14.40%	0.25%	0.25%	NA
Temperate Japonica	767	63.50%	0.10%	1.56%	34.81%	NA
Tropical Japonica	504	91.70%	6.90%	0.00%	1.39%	NA
Japonica Intermediate	241	76.30%	0.40%	1.24%	21.99%	NA
VI/Aromatic	96	42.70%	50.00%	1.04%	6.25%	NA
Intermediate	90	81.10%	15.60%	0.00%	3.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003133816	C -> T	LOC_Os10g06140-LOC_Os10g06160	intergenic_region ; MODIFIER	silent_mutation	Average:32.969; most accessible tissue: Callus, score: 55.669	N	N	N	N
vg1003133816	C -> DEL	N	N	silent_mutation	Average:32.969; most accessible tissue: Callus, score: 55.669	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003133816	9.61E-07	2.32E-08	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003133816	7.24E-09	1.71E-07	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003133816	4.71E-10	1.33E-11	mr1547	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003133816	8.94E-10	7.80E-13	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003133816	3.17E-10	6.49E-11	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003133816	NA	5.15E-09	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003133816	2.69E-09	4.05E-12	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003133816	1.10E-11	1.34E-14	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003133816	1.87E-14	3.36E-13	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003133816	2.41E-12	3.71E-12	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 11 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1003133816:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact