\
| Variant ID: vg1003132211 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3132211 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 101. )
GGGCTAAGGCTCATCTATTAATTCCAATAAGTGCGAGACCGCACGGTCTCGTGGAATGGAAGAGCGAGACCGTTCGGTCTCGCTGAAGCAATGAGCGACA[C/T]
TGTCTAACGGCTCCTTTTCATTAGTGATTAATTACTCAATTAACAATTAACTAATAAAAAATTAGTGATTAATTATCTGATTAGCGATTAAGTAATAATT
AATTATTACTTAATCGCTAATCAGATAATTAATCACTAATTTTTTATTAGTTAATTGTTAATTGAGTAATTAATCACTAATGAAAAGGAGCCGTTAGACA[G/A]
TGTCGCTCATTGCTTCAGCGAGACCGAACGGTCTCGCTCTTCCATTCCACGAGACCGTGCGGTCTCGCACTTATTGGAATTAATAGATGAGCCTTAGCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.70% | 30.10% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 53.40% | 46.40% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 48.70% | 51.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 56.10% | 43.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 61.60% | 38.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 45.70% | 53.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 25.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003132211 | C -> T | LOC_Os10g06140.1 | upstream_gene_variant ; 4939.0bp to feature; MODIFIER | silent_mutation | Average:55.35; most accessible tissue: Minghui63 root, score: 82.02 | N | N | N | N |
| vg1003132211 | C -> T | LOC_Os10g06140-LOC_Os10g06160 | intergenic_region ; MODIFIER | silent_mutation | Average:55.35; most accessible tissue: Minghui63 root, score: 82.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003132211 | 8.79E-06 | 8.79E-06 | mr1027 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 8.79E-08 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 7.13E-10 | 2.47E-12 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 1.56E-16 | 4.74E-13 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 3.92E-17 | 5.09E-22 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 2.34E-26 | 1.30E-34 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 3.94E-27 | 3.58E-37 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 9.52E-07 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 2.31E-11 | 2.42E-15 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 1.62E-18 | 2.49E-21 | mr1547_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 1.45E-20 | 3.72E-30 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 2.46E-41 | 4.42E-46 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003132211 | 2.13E-41 | 2.65E-59 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |