\
| Variant ID: vg1003124968 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3124968 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 107. )
ATATTTTGAACAACTTTTATATAGAAAATTTTCACACGAAACGCACTGTTTAGCAGTTTGAAAAGCATGCCACAAAAATCCAAAACTTTATCTCCCATGT[G/A]
TTGGGTTCTTAAACATGACCTTAGTAACTCCCTCCGTCCCAAAATATAACAACTTCGAGCCTCCAGATCTTTATCCCAAAATATAACAACTTCTACACCA
TGGTGTAGAAGTTGTTATATTTTGGGATAAAGATCTGGAGGCTCGAAGTTGTTATATTTTGGGACGGAGGGAGTTACTAAGGTCATGTTTAAGAACCCAA[C/T]
ACATGGGAGATAAAGTTTTGGATTTTTGTGGCATGCTTTTCAAACTGCTAAACAGTGCGTTTCGTGTGAAAATTTTCTATATAAAAGTTGTTCAAAATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.80% | 22.40% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 62.30% | 37.30% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 97.50% | 0.90% | 1.65% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 55.00% | 44.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 74.60% | 24.70% | 0.65% | 0.00% | NA |
| Indica III | 913 | 54.10% | 45.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 70.10% | 29.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 95.80% | 1.30% | 2.87% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 15.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003124968 | G -> A | LOC_Os10g06140.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.286; most accessible tissue: Callus, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003124968 | 1.50E-13 | NA | mr1538 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 3.59E-12 | 1.12E-13 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 1.77E-21 | 4.07E-25 | mr1547 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 7.39E-17 | 1.42E-22 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 3.73E-44 | 1.13E-55 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 7.14E-43 | 1.05E-67 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 4.44E-12 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 6.56E-15 | 4.48E-21 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 1.23E-18 | 1.30E-24 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 1.13E-20 | 6.39E-29 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 1.91E-60 | 1.74E-92 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003124968 | 8.26E-64 | 2.46E-108 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |