\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003115842:

Variant ID: vg1003115842 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3115842
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.24, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TGACCGTGCACCCATGCTGCCAGCTGGGTAGCTGGAAATGGGGAATTGAGGAATAGAGATGCTGGATATTGGTTAACTAGGGTTTGGTGTTGGGCATTGT[G/A]
GGCCACTGGGCCTTATAGGCAGACTGTAGCTGAAGTGGCGATGCTCAAGAATGGGTCATTTTGTGGACTGAGGGTTTAGTGGATGGACAAAAAGAGCCAG

Reverse complement sequence

CTGGCTCTTTTTGTCCATCCACTAAACCCTCAGTCCACAAAATGACCCATTCTTGAGCATCGCCACTTCAGCTACAGTCTGCCTATAAGGCCCAGTGGCC[C/T]
ACAATGCCCAACACCAAACCCTAGTTAACCAATATCCAGCATCTCTATTCCTCAATTCCCCATTTCCAGCTACCCAGCTGGCAGCATGGGTGCACGGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.80% 30.70% 0.36% 0.13% NA
All Indica  2759 72.90% 26.40% 0.54% 0.22% NA
All Japonica  1512 73.50% 26.50% 0.07% 0.00% NA
Aus  269 7.80% 91.80% 0.37% 0.00% NA
Indica I  595 78.70% 21.30% 0.00% 0.00% NA
Indica II  465 55.90% 42.40% 1.29% 0.43% NA
Indica III  913 77.40% 21.90% 0.55% 0.11% NA
Indica Intermediate  786 73.30% 25.80% 0.51% 0.38% NA
Temperate Japonica  767 62.10% 37.90% 0.00% 0.00% NA
Tropical Japonica  504 90.30% 9.70% 0.00% 0.00% NA
Japonica Intermediate  241 74.70% 24.90% 0.41% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003115842 G -> A LOC_Os10g06130.3 3_prime_UTR_variant ; 146.0bp to feature; MODIFIER silent_mutation Average:82.031; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N
vg1003115842 G -> A LOC_Os10g06130.4 3_prime_UTR_variant ; 146.0bp to feature; MODIFIER silent_mutation Average:82.031; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N
vg1003115842 G -> A LOC_Os10g06130.5 3_prime_UTR_variant ; 146.0bp to feature; MODIFIER silent_mutation Average:82.031; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N
vg1003115842 G -> A LOC_Os10g06110.1 upstream_gene_variant ; 2504.0bp to feature; MODIFIER silent_mutation Average:82.031; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N
vg1003115842 G -> A LOC_Os10g06130.1 intron_variant ; MODIFIER silent_mutation Average:82.031; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N
vg1003115842 G -> A LOC_Os10g06130.2 intron_variant ; MODIFIER silent_mutation Average:82.031; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N
vg1003115842 G -> DEL N N silent_mutation Average:82.031; most accessible tissue: Zhenshan97 young leaf, score: 91.389 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1003115842 G A 0.0 -0.02 -0.02 0.0 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003115842 NA 4.98E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 NA 2.23E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 5.63E-08 2.56E-08 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 7.02E-06 1.19E-07 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 NA 9.43E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 NA 4.47E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 NA 3.43E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 3.01E-16 1.03E-22 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 1.53E-14 2.79E-19 mr1709 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 NA 4.51E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 NA 4.59E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 NA 4.21E-08 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 3.21E-07 9.12E-10 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 3.96E-08 2.33E-09 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 4.91E-23 5.99E-35 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 6.87E-14 5.96E-18 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003115842 9.89E-12 1.73E-20 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251