\
| Variant ID: vg1003107608 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3107608 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGCATTGACTGATCAAATTTTAGTACCAGTGTTTGTATTTAAACAACGACGGTTCTGTCCACCATCCATTGTGATCCCAAGGATAGCTTCCCGCCATTG[A/T]
GTCGTTATGGTTTTCTGAGGACGTCCACTTTCCCCTATCTCAAGAAGTGACTCCAACAGCATAGAAATTTCATCATGCAATAACATATCCCACACAAGTT
AACTTGTGTGGGATATGTTATTGCATGATGAAATTTCTATGCTGTTGGAGTCACTTCTTGAGATAGGGGAAAGTGGACGTCCTCAGAAAACCATAACGAC[T/A]
CAATGGCGGGAAGCTATCCTTGGGATCACAATGGATGGTGGACAGAACCGTCGTTGTTTAAATACAAACACTGGTACTAAAATTTGATCAGTCAATGCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 2.80% | 11.85% | 33.07% | NA |
| All Indica | 2759 | 44.70% | 3.20% | 12.76% | 39.40% | NA |
| All Japonica | 1512 | 73.90% | 0.50% | 3.64% | 21.89% | NA |
| Aus | 269 | 14.90% | 11.20% | 43.12% | 30.86% | NA |
| Indica I | 595 | 48.70% | 3.40% | 7.39% | 40.50% | NA |
| Indica II | 465 | 29.50% | 1.70% | 8.60% | 60.22% | NA |
| Indica III | 913 | 56.20% | 3.30% | 15.88% | 24.64% | NA |
| Indica Intermediate | 786 | 37.30% | 3.70% | 15.65% | 43.38% | NA |
| Temperate Japonica | 767 | 62.80% | 0.00% | 2.61% | 34.55% | NA |
| Tropical Japonica | 504 | 89.10% | 1.00% | 5.16% | 4.76% | NA |
| Japonica Intermediate | 241 | 77.60% | 1.20% | 3.73% | 17.43% | NA |
| VI/Aromatic | 96 | 32.30% | 4.20% | 28.12% | 35.42% | NA |
| Intermediate | 90 | 56.70% | 1.10% | 11.11% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003107608 | A -> T | LOC_Os10g06100.1 | upstream_gene_variant ; 579.0bp to feature; MODIFIER | silent_mutation | Average:28.723; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg1003107608 | A -> T | LOC_Os10g06110.1 | downstream_gene_variant ; 2967.0bp to feature; MODIFIER | silent_mutation | Average:28.723; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg1003107608 | A -> T | LOC_Os10g06100-LOC_Os10g06110 | intergenic_region ; MODIFIER | silent_mutation | Average:28.723; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg1003107608 | A -> DEL | N | N | silent_mutation | Average:28.723; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003107608 | 2.44E-06 | 5.21E-11 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003107608 | 2.42E-08 | 2.44E-11 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003107608 | NA | 8.52E-07 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003107608 | 2.32E-06 | 3.28E-18 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003107608 | 1.82E-08 | 2.72E-15 | mr1709_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |