\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003107608:

Variant ID: vg1003107608 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3107608
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCATTGACTGATCAAATTTTAGTACCAGTGTTTGTATTTAAACAACGACGGTTCTGTCCACCATCCATTGTGATCCCAAGGATAGCTTCCCGCCATTG[A/T]
GTCGTTATGGTTTTCTGAGGACGTCCACTTTCCCCTATCTCAAGAAGTGACTCCAACAGCATAGAAATTTCATCATGCAATAACATATCCCACACAAGTT

Reverse complement sequence

AACTTGTGTGGGATATGTTATTGCATGATGAAATTTCTATGCTGTTGGAGTCACTTCTTGAGATAGGGGAAAGTGGACGTCCTCAGAAAACCATAACGAC[T/A]
CAATGGCGGGAAGCTATCCTTGGGATCACAATGGATGGTGGACAGAACCGTCGTTGTTTAAATACAAACACTGGTACTAAAATTTGATCAGTCAATGCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 2.80% 11.85% 33.07% NA
All Indica  2759 44.70% 3.20% 12.76% 39.40% NA
All Japonica  1512 73.90% 0.50% 3.64% 21.89% NA
Aus  269 14.90% 11.20% 43.12% 30.86% NA
Indica I  595 48.70% 3.40% 7.39% 40.50% NA
Indica II  465 29.50% 1.70% 8.60% 60.22% NA
Indica III  913 56.20% 3.30% 15.88% 24.64% NA
Indica Intermediate  786 37.30% 3.70% 15.65% 43.38% NA
Temperate Japonica  767 62.80% 0.00% 2.61% 34.55% NA
Tropical Japonica  504 89.10% 1.00% 5.16% 4.76% NA
Japonica Intermediate  241 77.60% 1.20% 3.73% 17.43% NA
VI/Aromatic  96 32.30% 4.20% 28.12% 35.42% NA
Intermediate  90 56.70% 1.10% 11.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003107608 A -> T LOC_Os10g06100.1 upstream_gene_variant ; 579.0bp to feature; MODIFIER silent_mutation Average:28.723; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg1003107608 A -> T LOC_Os10g06110.1 downstream_gene_variant ; 2967.0bp to feature; MODIFIER silent_mutation Average:28.723; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg1003107608 A -> T LOC_Os10g06100-LOC_Os10g06110 intergenic_region ; MODIFIER silent_mutation Average:28.723; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg1003107608 A -> DEL N N silent_mutation Average:28.723; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003107608 2.44E-06 5.21E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003107608 2.42E-08 2.44E-11 mr1709 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003107608 NA 8.52E-07 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003107608 2.32E-06 3.28E-18 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003107608 1.82E-08 2.72E-15 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251