\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003101362:

Variant ID: vg1003101362 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3101362
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCAGTGGTTGGTTTAATATTGGCTAATTATTACAACTGTTTTACTGCTTTCAATTACTGTTTATAAATGCTAGCTTTATACAAATGAACTCTTTTAGC[T/C]
GTCCTTTGGTTATACCTTGCATCATACCCTCCATTCCGGTAGGACTTGCTGAGTACAGTGGGTAGTTCTTGCTCTATCTCCCAACCCTCAGAGTTCAAGT

Reverse complement sequence

ACTTGAACTCTGAGGGTTGGGAGATAGAGCAAGAACTACCCACTGTACTCAGCAAGTCCTACCGGAATGGAGGGTATGATGCAAGGTATAACCAAAGGAC[A/G]
GCTAAAAGAGTTCATTTGTATAAAGCTAGCATTTATAAACAGTAATTGAAAGCAGTAAAACAGTTGTAATAATTAGCCAATATTAAACCAACCACTGCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.20% 23.90% 0.95% 47.95% NA
All Indica  2759 4.90% 38.90% 1.45% 54.73% NA
All Japonica  1512 71.90% 0.70% 0.13% 27.25% NA
Aus  269 4.10% 3.70% 0.37% 91.82% NA
Indica I  595 1.00% 45.90% 0.50% 52.61% NA
Indica II  465 1.90% 27.30% 2.37% 68.39% NA
Indica III  913 10.20% 46.70% 1.53% 41.62% NA
Indica Intermediate  786 3.40% 31.60% 1.53% 63.49% NA
Temperate Japonica  767 61.30% 0.80% 0.26% 37.68% NA
Tropical Japonica  504 87.70% 0.20% 0.00% 12.10% NA
Japonica Intermediate  241 72.60% 1.70% 0.00% 25.73% NA
VI/Aromatic  96 24.00% 16.70% 0.00% 59.38% NA
Intermediate  90 34.40% 18.90% 2.22% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003101362 T -> C LOC_Os10g06090.1 downstream_gene_variant ; 3917.0bp to feature; MODIFIER silent_mutation Average:38.724; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1003101362 T -> C LOC_Os10g06100.1 downstream_gene_variant ; 4121.0bp to feature; MODIFIER silent_mutation Average:38.724; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1003101362 T -> C LOC_Os10g06090-LOC_Os10g06100 intergenic_region ; MODIFIER silent_mutation Average:38.724; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg1003101362 T -> DEL N N silent_mutation Average:38.724; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003101362 9.48E-06 9.48E-06 mr1027 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 4.69E-06 3.20E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 2.35E-09 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 3.35E-10 1.98E-12 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 1.03E-15 8.90E-21 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 6.59E-15 1.14E-20 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 2.56E-24 1.61E-43 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 1.17E-34 7.88E-63 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 5.13E-13 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 3.55E-14 5.04E-20 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 1.90E-16 3.39E-23 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 6.53E-19 1.75E-26 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 1.55E-26 1.27E-76 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003101362 4.29E-45 4.92E-98 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251