\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003100708:

Variant ID: vg1003100708 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3100708
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCCCTCTCTCCACACCTCCCCCACTTCGCCGGCCACTCCCCGCCTCTCTCGGCCACGTCCGACCTCCCCAGCCCTATATAAAGCACCACCGCTTCCTC[C/T]
TCCACCTTTTTCCCTCTTTCGCCATCCGCTCCCGAGCTCTCCTTCGCCTTAGCACCATGCACCACCCGCCATCATGCGCCCATGGCAATTAATGACCGGT

Reverse complement sequence

ACCGGTCATTAATTGCCATGGGCGCATGATGGCGGGTGGTGCATGGTGCTAAGGCGAAGGAGAGCTCGGGAGCGGATGGCGAAAGAGGGAAAAAGGTGGA[G/A]
GAGGAAGCGGTGGTGCTTTATATAGGGCTGGGGAGGTCGGACGTGGCCGAGAGAGGCGGGGAGTGGCCGGCGAAGTGGGGGAGGTGTGGAGAGAGGGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 22.80% 2.96% 25.35% NA
All Indica  2759 38.60% 38.10% 4.42% 18.88% NA
All Japonica  1512 73.30% 0.70% 0.33% 25.73% NA
Aus  269 14.90% 0.40% 2.60% 82.16% NA
Indica I  595 35.50% 45.70% 3.53% 15.29% NA
Indica II  465 33.80% 27.10% 6.02% 33.12% NA
Indica III  913 37.00% 44.90% 4.27% 13.80% NA
Indica Intermediate  786 45.80% 30.80% 4.33% 19.08% NA
Temperate Japonica  767 61.70% 0.80% 0.26% 37.29% NA
Tropical Japonica  504 90.30% 0.20% 0.60% 8.93% NA
Japonica Intermediate  241 74.70% 1.20% 0.00% 24.07% NA
VI/Aromatic  96 51.00% 1.00% 5.21% 42.71% NA
Intermediate  90 53.30% 16.70% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003100708 C -> T LOC_Os10g06090.1 downstream_gene_variant ; 3263.0bp to feature; MODIFIER silent_mutation Average:49.378; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N
vg1003100708 C -> T LOC_Os10g06100.1 downstream_gene_variant ; 4775.0bp to feature; MODIFIER silent_mutation Average:49.378; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N
vg1003100708 C -> T LOC_Os10g06090-LOC_Os10g06100 intergenic_region ; MODIFIER silent_mutation Average:49.378; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N
vg1003100708 C -> DEL N N silent_mutation Average:49.378; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003100708 4.69E-06 3.20E-06 mr1201 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 8.72E-09 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 6.94E-10 2.55E-12 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 2.11E-14 2.17E-19 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 6.71E-14 8.86E-20 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 3.17E-22 2.01E-40 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 1.29E-30 9.12E-58 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 1.30E-11 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 1.28E-12 1.84E-18 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 5.74E-16 9.43E-22 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 3.07E-18 6.82E-25 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 2.18E-24 1.02E-71 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003100708 1.22E-36 1.34E-88 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251