\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003097804:

Variant ID: vg1003097804 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3097804
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCAAGAATTTCATAGAGCTAAAGTAGCTTGGAATGTGTATAGAAGCTTTTTATTTGTATAGTAAACACTATATATCTAATGATCTAAATCGTTTGTTG[A/G]
CAAGCTACAAAGCTAACTAATATTTGCTTCATCATCAAATGAAATGTCTGCTGAAAATTATATTGTCCTGATCAATACTATTTATCCAATCCTGCATTGA

Reverse complement sequence

TCAATGCAGGATTGGATAAATAGTATTGATCAGGACAATATAATTTTCAGCAGACATTTCATTTGATGATGAAGCAAATATTAGTTAGCTTTGTAGCTTG[T/C]
CAACAAACGATTTAGATCATTAGATATATAGTGTTTACTATACAAATAAAAAGCTTCTATACACATTCCAAGCTACTTTAGCTCTATGAAATTCTTGAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 30.00% 0.19% 0.53% NA
All Indica  2759 73.70% 25.10% 0.25% 0.91% NA
All Japonica  1512 73.70% 26.30% 0.00% 0.00% NA
Aus  269 7.10% 92.60% 0.37% 0.00% NA
Indica I  595 79.50% 20.50% 0.00% 0.00% NA
Indica II  465 57.40% 42.20% 0.22% 0.22% NA
Indica III  913 77.80% 19.70% 0.33% 2.19% NA
Indica Intermediate  786 74.30% 24.80% 0.38% 0.51% NA
Temperate Japonica  767 62.60% 37.40% 0.00% 0.00% NA
Tropical Japonica  504 90.30% 9.70% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 46.90% 1.04% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003097804 A -> G LOC_Os10g06090.1 downstream_gene_variant ; 359.0bp to feature; MODIFIER silent_mutation Average:37.883; most accessible tissue: Callus, score: 68.378 N N N N
vg1003097804 A -> G LOC_Os10g06090-LOC_Os10g06100 intergenic_region ; MODIFIER silent_mutation Average:37.883; most accessible tissue: Callus, score: 68.378 N N N N
vg1003097804 A -> DEL N N silent_mutation Average:37.883; most accessible tissue: Callus, score: 68.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003097804 NA 4.21E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 NA 2.02E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 NA 7.93E-06 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 1.41E-08 8.84E-09 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 2.15E-06 3.32E-08 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 NA 6.21E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 NA 2.47E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 NA 1.68E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 8.73E-17 1.78E-22 mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 1.36E-13 3.51E-18 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 NA 2.12E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 NA 1.83E-07 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 6.33E-07 2.36E-09 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 1.41E-07 7.70E-09 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 8.56E-24 2.49E-34 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 8.60E-15 1.61E-17 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003097804 2.25E-11 2.42E-20 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251