\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003096745:

Variant ID: vg1003096745 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3096745
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGTTGCTTGGAGGTGGATGTTCCAATGTTAGTGTATGAGTTTGCCGCTAATGGGAGTCTGCAAGACATTCTCCATGGTGATGCCAATCGCTCACTCC[T/C]
TCTCACACTAGACATACGCTTGGACATTGCAATTGAATCTGCAGAAGGTCTAAAATACATGCACTCGTCCACAAATTGTACCATACGACATGGTGATGTC

Reverse complement sequence

GACATCACCATGTCGTATGGTACAATTTGTGGACGAGTGCATGTATTTTAGACCTTCTGCAGATTCAATTGCAATGTCCAAGCGTATGTCTAGTGTGAGA[A/G]
GGAGTGAGCGATTGGCATCACCATGGAGAATGTCTTGCAGACTCCCATTAGCGGCAAACTCATACACTAACATTGGAACATCCACCTCCAAGCAACAACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 49.10% 0.34% 0.61% NA
All Indica  2759 42.00% 56.40% 0.54% 1.05% NA
All Japonica  1512 72.50% 27.50% 0.00% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 45.90% 53.40% 0.50% 0.17% NA
Indica II  465 26.20% 72.50% 1.08% 0.22% NA
Indica III  913 55.10% 42.20% 0.33% 2.41% NA
Indica Intermediate  786 33.30% 65.50% 0.51% 0.64% NA
Temperate Japonica  767 62.10% 37.90% 0.00% 0.00% NA
Tropical Japonica  504 87.70% 12.30% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 40.60% 59.40% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003096745 T -> C LOC_Os10g06090.1 missense_variant ; p.Leu516Pro; MODERATE nonsynonymous_codon ; L516P Average:48.422; most accessible tissue: Callus, score: 63.952 possibly damaging -1.533 TOLERATED 1.00
vg1003096745 T -> DEL LOC_Os10g06090.1 N frameshift_variant Average:48.422; most accessible tissue: Callus, score: 63.952 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003096745 5.69E-06 5.69E-06 mr1027 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 NA 4.98E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 NA 2.23E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 1.01E-08 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 4.45E-12 4.40E-14 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 2.53E-21 4.44E-20 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 3.75E-19 3.28E-25 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 NA 4.47E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 NA 3.43E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 1.87E-42 1.12E-62 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 1.13E-48 1.10E-76 mr1709 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 NA 4.51E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 NA 4.59E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 NA 8.08E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 8.35E-08 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 1.08E-12 2.17E-18 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 5.19E-17 8.40E-23 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 2.86E-20 3.78E-28 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 8.60E-79 1.81E-120 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 8.02E-73 2.77E-126 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003096745 9.89E-12 1.73E-20 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251