\
| Variant ID: vg1003095982 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3095982 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 88. )
TTTTGTTACGGCTAAAATATAATGAACTTGAATATGAGACTTTATATATATGTGTAGTACTAATAGGAGTAAATGTTTAATTTTATAGAATTTTTCGTGA[T/C]
ATTTGTTAGTTGGTGCGCACGAGAAACATGTGTACATAGAATATGTTCCTGGTAACCATATATGATCTTTAGTGAGTTACAAATATCCTAACTATTTTCA
TGAAAATAGTTAGGATATTTGTAACTCACTAAAGATCATATATGGTTACCAGGAACATATTCTATGTACACATGTTTCTCGTGCGCACCAACTAACAAAT[A/G]
TCACGAAAAATTCTATAAAATTAAACATTTACTCCTATTAGTACTACACATATATATAAAGTCTCATATTCAAGTTCATTATATTTTAGCCGTAACAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.10% | 34.80% | 0.32% | 5.78% | NA |
| All Indica | 2759 | 57.60% | 41.10% | 0.14% | 1.12% | NA |
| All Japonica | 1512 | 72.60% | 11.40% | 0.53% | 15.48% | NA |
| Aus | 269 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.50% | 34.80% | 0.00% | 0.67% | NA |
| Indica II | 465 | 40.00% | 59.40% | 0.43% | 0.22% | NA |
| Indica III | 913 | 70.20% | 27.40% | 0.22% | 2.19% | NA |
| Indica Intermediate | 786 | 48.20% | 51.00% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 62.20% | 10.70% | 0.78% | 26.34% | NA |
| Tropical Japonica | 504 | 87.70% | 11.50% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 74.30% | 13.30% | 0.83% | 11.62% | NA |
| VI/Aromatic | 96 | 40.60% | 54.20% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 51.10% | 42.20% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003095982 | T -> C | LOC_Os10g06090.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.091; most accessible tissue: Callus, score: 50.957 | N | N | N | N |
| vg1003095982 | T -> DEL | N | N | silent_mutation | Average:28.091; most accessible tissue: Callus, score: 50.957 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003095982 | NA | 9.54E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | NA | 6.20E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | NA | 1.01E-06 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | NA | 5.61E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | NA | 5.57E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | NA | 6.87E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | 2.43E-13 | 1.59E-26 | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | 2.13E-11 | 1.58E-21 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | NA | 1.68E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | NA | 8.51E-08 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | 4.60E-27 | 3.58E-53 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | 9.42E-19 | 4.50E-32 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | 4.50E-11 | 2.23E-19 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003095982 | NA | 1.01E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |