\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003093171:

Variant ID: vg1003093171 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3093171
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTTATTTTAGTATGGAGAGTGTATGTCCGAGTCCGAATATACTTTAATGTAGCATAAAAAGAATCATTTTTAAACCATGTCACTAAATAGCACCAAC[A/G]
CTACTCAGTACTTGAATGACATGACATCATTTCTATTCATCCTTTTTAGTTTTGGAGACTTGCAGCCACATCCCTTAGCTATGTCAATTAACTCAGGTGG

Reverse complement sequence

CCACCTGAGTTAATTGACATAGCTAAGGGATGTGGCTGCAAGTCTCCAAAACTAAAAAGGATGAATAGAAATGATGTCATGTCATTCAAGTACTGAGTAG[T/C]
GTTGGTGCTATTTAGTGACATGGTTTAAAAATGATTCTTTTTATGCTACATTAAAGTATATTCGGACTCGGACATACACTCTCCATACTAAAATAAGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 49.20% 0.55% 0.70% NA
All Indica  2759 41.40% 56.60% 0.87% 1.20% NA
All Japonica  1512 72.60% 27.40% 0.00% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 44.70% 52.90% 2.18% 0.17% NA
Indica II  465 26.90% 72.00% 0.22% 0.86% NA
Indica III  913 54.80% 42.40% 0.44% 2.41% NA
Indica Intermediate  786 31.80% 66.70% 0.76% 0.76% NA
Temperate Japonica  767 62.20% 37.80% 0.00% 0.00% NA
Tropical Japonica  504 87.70% 12.30% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 40.60% 59.40% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003093171 A -> G LOC_Os10g06090.1 intron_variant ; MODIFIER silent_mutation Average:45.061; most accessible tissue: Minghui63 root, score: 58.187 N N N N
vg1003093171 A -> DEL N N silent_mutation Average:45.061; most accessible tissue: Minghui63 root, score: 58.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003093171 1.21E-06 1.21E-06 mr1027 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 NA 4.98E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 NA 2.23E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 4.65E-08 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 4.93E-11 3.44E-13 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 2.62E-19 1.74E-18 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 3.61E-17 1.26E-23 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 NA 4.47E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 NA 3.43E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 1.04E-35 5.10E-57 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 4.23E-39 3.08E-67 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 NA 4.51E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 NA 4.59E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 NA 2.24E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 NA 8.24E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 NA 1.74E-06 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 NA 9.81E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 2.39E-07 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 3.68E-12 6.25E-17 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 3.30E-17 1.51E-22 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 5.13E-21 1.62E-28 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 1.40E-73 3.78E-115 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 7.01E-66 8.01E-117 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003093171 9.89E-12 1.73E-20 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251