\
| Variant ID: vg1003093171 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3093171 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 101. )
AAACTTATTTTAGTATGGAGAGTGTATGTCCGAGTCCGAATATACTTTAATGTAGCATAAAAAGAATCATTTTTAAACCATGTCACTAAATAGCACCAAC[A/G]
CTACTCAGTACTTGAATGACATGACATCATTTCTATTCATCCTTTTTAGTTTTGGAGACTTGCAGCCACATCCCTTAGCTATGTCAATTAACTCAGGTGG
CCACCTGAGTTAATTGACATAGCTAAGGGATGTGGCTGCAAGTCTCCAAAACTAAAAAGGATGAATAGAAATGATGTCATGTCATTCAAGTACTGAGTAG[T/C]
GTTGGTGCTATTTAGTGACATGGTTTAAAAATGATTCTTTTTATGCTACATTAAAGTATATTCGGACTCGGACATACACTCTCCATACTAAAATAAGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.50% | 49.20% | 0.55% | 0.70% | NA |
| All Indica | 2759 | 41.40% | 56.60% | 0.87% | 1.20% | NA |
| All Japonica | 1512 | 72.60% | 27.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 44.70% | 52.90% | 2.18% | 0.17% | NA |
| Indica II | 465 | 26.90% | 72.00% | 0.22% | 0.86% | NA |
| Indica III | 913 | 54.80% | 42.40% | 0.44% | 2.41% | NA |
| Indica Intermediate | 786 | 31.80% | 66.70% | 0.76% | 0.76% | NA |
| Temperate Japonica | 767 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.90% | 26.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 40.60% | 59.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 48.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003093171 | A -> G | LOC_Os10g06090.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.061; most accessible tissue: Minghui63 root, score: 58.187 | N | N | N | N |
| vg1003093171 | A -> DEL | N | N | silent_mutation | Average:45.061; most accessible tissue: Minghui63 root, score: 58.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003093171 | 1.21E-06 | 1.21E-06 | mr1027 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | NA | 4.98E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | NA | 2.23E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 4.65E-08 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 4.93E-11 | 3.44E-13 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 2.62E-19 | 1.74E-18 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 3.61E-17 | 1.26E-23 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | NA | 4.47E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | NA | 3.43E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 1.04E-35 | 5.10E-57 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 4.23E-39 | 3.08E-67 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | NA | 4.51E-06 | mr1922 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | NA | 4.59E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | NA | 2.24E-07 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | NA | 8.24E-07 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | NA | 1.74E-06 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | NA | 9.81E-07 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 2.39E-07 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 3.68E-12 | 6.25E-17 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 3.30E-17 | 1.51E-22 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 5.13E-21 | 1.62E-28 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 1.40E-73 | 3.78E-115 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 7.01E-66 | 8.01E-117 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003093171 | 9.89E-12 | 1.73E-20 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |