\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003087335:

Variant ID: vg1003087335 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3087335
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.21, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CATGAAATGGATATATTTAATATTTTAACTCAAATTCTATATAAAATATTTTTCACAGAACGTACCGATTATTAGTTTGAAAAGTGTGTTAATAAAAACT[A/G]
GGACACAATTTGTATCTTAATGAAAACTGGAACATACTAATTATTTTCACTTCGTGCATGTGTGGTAGCTAGCTGCAGTAAATAATTGACTATACTCGCT

Reverse complement sequence

AGCGAGTATAGTCAATTATTTACTGCAGCTAGCTACCACACATGCACGAAGTGAAAATAATTAGTATGTTCCAGTTTTCATTAAGATACAAATTGTGTCC[T/C]
AGTTTTTATTAACACACTTTTCAAACTAATAATCGGTACGTTCTGTGAAAAATATTTTATATAGAATTTGAGTTAAAATATTAAATATATCCATTTCATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 35.60% 0.23% 0.53% NA
All Indica  2759 52.60% 46.20% 0.33% 0.91% NA
All Japonica  1512 75.30% 24.60% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 48.10% 51.60% 0.34% 0.00% NA
Indica II  465 57.00% 42.20% 0.65% 0.22% NA
Indica III  913 60.10% 37.50% 0.22% 2.19% NA
Indica Intermediate  786 44.70% 54.60% 0.25% 0.51% NA
Temperate Japonica  767 62.10% 37.90% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 74.70% 24.90% 0.41% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003087335 A -> G LOC_Os10g06080.1 upstream_gene_variant ; 2134.0bp to feature; MODIFIER silent_mutation Average:50.044; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg1003087335 A -> G LOC_Os10g06090.1 upstream_gene_variant ; 3261.0bp to feature; MODIFIER silent_mutation Average:50.044; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg1003087335 A -> G LOC_Os10g06080-LOC_Os10g06090 intergenic_region ; MODIFIER silent_mutation Average:50.044; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg1003087335 A -> DEL N N silent_mutation Average:50.044; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003087335 NA 3.06E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 NA 6.20E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 NA 4.09E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 1.09E-08 1.88E-11 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 2.46E-18 4.52E-19 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 7.82E-16 1.57E-20 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 NA 2.43E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 NA 5.82E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 4.21E-28 4.49E-38 mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 1.65E-28 7.64E-40 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 NA 7.34E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 NA 8.95E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 8.83E-07 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 1.29E-09 1.32E-13 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 2.39E-16 3.06E-21 mr1547_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 4.24E-18 1.16E-26 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 3.95E-55 1.11E-65 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 1.30E-46 2.80E-63 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003087335 2.40E-11 4.03E-18 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251