Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003086515:

Variant ID: vg1003086515 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3086515
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AGCACATTGACTAATATTTAAAGGGAACAGATAATTACATTTTACAAAATGTTGTCAAATTTTTGTTTAAGTTCTATCAAAATGCTGAAATTTTGTCAAA[A/T]
TTCCATCAAATTCAGAATTTTTCCAAATTGTTATATTAGTCAATGTGCGTCATCTAATTTAAAATATACTCTCAAAAATAAAGTTCCAAAGCTACATGTA

Reverse complement sequence

TACATGTAGCTTTGGAACTTTATTTTTGAGAGTATATTTTAAATTAGATGACGCACATTGACTAATATAACAATTTGGAAAAATTCTGAATTTGATGGAA[T/A]
TTTGACAAAATTTCAGCATTTTGATAGAACTTAAACAAAAATTTGACAACATTTTGTAAAATGTAATTATCTGTTCCCTTTAAATATTAGTCAATGTGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.90%	0.30%	0.93%	44.90%	NA
All Indica	2759	46.10%	0.50%	1.12%	52.30%	NA
All Japonica	1512	75.10%	0.00%	0.13%	24.74%	NA
Aus	269	13.80%	0.00%	4.09%	82.16%	NA
Indica I	595	48.70%	0.80%	1.68%	48.74%	NA
Indica II	465	30.80%	1.10%	0.22%	67.96%	NA
Indica III	913	60.40%	0.20%	0.77%	38.66%	NA
Indica Intermediate	786	36.60%	0.10%	1.65%	61.58%	NA
Temperate Japonica	767	62.50%	0.00%	0.26%	37.29%	NA
Tropical Japonica	504	94.60%	0.00%	0.00%	5.36%	NA
Japonica Intermediate	241	74.70%	0.00%	0.00%	25.31%	NA
VI/Aromatic	96	51.00%	0.00%	0.00%	48.96%	NA
Intermediate	90	58.90%	0.00%	0.00%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003086515	A -> T	LOC_Os10g06070.1	upstream_gene_variant ; 4513.0bp to feature; MODIFIER	silent_mutation	Average:15.808; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1003086515	A -> T	LOC_Os10g06080.1	upstream_gene_variant ; 1314.0bp to feature; MODIFIER	silent_mutation	Average:15.808; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1003086515	A -> T	LOC_Os10g06090.1	upstream_gene_variant ; 4081.0bp to feature; MODIFIER	silent_mutation	Average:15.808; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1003086515	A -> T	LOC_Os10g06080-LOC_Os10g06090	intergenic_region ; MODIFIER	silent_mutation	Average:15.808; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1003086515	A -> DEL	N	N	silent_mutation	Average:15.808; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003086515	5.78E-07	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	1.76E-09	2.31E-11	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	4.42E-19	1.78E-20	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	7.76E-15	2.09E-21	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	NA	1.47E-06	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	1.50E-22	1.29E-41	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	6.63E-26	3.24E-49	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	NA	6.30E-06	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	NA	8.61E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	NA	8.76E-08	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	NA	9.23E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	NA	7.25E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	2.55E-06	4.51E-12	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	1.90E-10	1.42E-15	mr1547_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	5.30E-12	2.11E-19	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	3.45E-37	8.58E-84	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	6.03E-36	7.97E-74	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	1.30E-06	2.77E-15	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003086515	NA	9.79E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251