\
| Variant ID: vg1003077652 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3077652 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.11, others allele: 0.00, population size: 109. )
CAGCCACAGCAGCCATCAGAGGGTTCAGGGTATCGCCGTGTCACACCATAAAGTTCTTCTCCCAAGCCTAAATCGTATTAATAAATGACCCCAATAAATT[G/A]
TTTGAGTAATGGCAAGAGAGAAACCCTAATTTAATAAATTCAATTAATAATCGGAATTAGCATGTGGAATTTTTCTTGGGTTCTACATGTCAAAATATGC
GCATATTTTGACATGTAGAACCCAAGAAAAATTCCACATGCTAATTCCGATTATTAATTGAATTTATTAAATTAGGGTTTCTCTCTTGCCATTACTCAAA[C/T]
AATTTATTGGGGTCATTTATTAATACGATTTAGGCTTGGGAGAAGAACTTTATGGTGTGACACGGCGATACCCTGAACCCTCTGATGGCTGCTGTGGCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.70% | 8.70% | 0.08% | 0.51% | NA |
| All Indica | 2759 | 84.20% | 14.80% | 0.14% | 0.87% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.20% | 17.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 86.90% | 12.70% | 0.22% | 0.22% | NA |
| Indica III | 913 | 83.10% | 14.60% | 0.22% | 2.08% | NA |
| Indica Intermediate | 786 | 85.50% | 14.00% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003077652 | G -> A | LOC_Os10g06050.1 | downstream_gene_variant ; 1272.0bp to feature; MODIFIER | silent_mutation | Average:27.395; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
| vg1003077652 | G -> A | LOC_Os10g06070.1 | downstream_gene_variant ; 2440.0bp to feature; MODIFIER | silent_mutation | Average:27.395; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
| vg1003077652 | G -> A | LOC_Os10g06050-LOC_Os10g06070 | intergenic_region ; MODIFIER | silent_mutation | Average:27.395; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
| vg1003077652 | G -> DEL | N | N | silent_mutation | Average:27.395; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003077652 | 4.73E-06 | 2.05E-07 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | 5.25E-10 | 1.44E-09 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | 1.13E-08 | 2.22E-10 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | 1.01E-12 | 1.60E-14 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | 1.52E-10 | 1.03E-11 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | NA | 4.19E-06 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | NA | 6.70E-09 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | 1.07E-11 | 6.29E-13 | mr1547_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | 3.27E-11 | 2.83E-14 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | 1.16E-17 | 8.36E-15 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | 1.45E-12 | 1.81E-12 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003077652 | NA | 1.53E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |