\
| Variant ID: vg1003073690 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3073690 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 295. )
TGGCCGAGAAACAACCACCACCACCATCTAGCCCAGGCTTTGTTAAGGACAAGATGCTAAAGCTAGGATTGACTGACGTCAATGAAGGAAACGTCGTGCC[G/A]
ATCGATCCAGAAAAATTCACACCTGAGCAGAAGAAAGAGTTTGAAGCAATGTTGCAGCAAGTACGGGATTAGTTCTTGAACTCATTCATGTAGACCCGCA
TGCGGGTCTACATGAATGAGTTCAAGAACTAATCCCGTACTTGCTGCAACATTGCTTCAAACTCTTTCTTCTGCTCAGGTGTGAATTTTTCTGGATCGAT[C/T]
GGCACGACGTTTCCTTCATTGACGTCAGTCAATCCTAGCTTTAGCATCTTGTCCTTAACAAAGCCTGGGCTAGATGGTGGTGGTGGTTGTTTCTCGGCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.40% | 9.10% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 85.00% | 14.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 97.50% | 1.30% | 1.19% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.00% | 17.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 87.10% | 12.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 85.10% | 14.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 86.00% | 14.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.00% | 2.60% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003073690 | G -> A | LOC_Os10g06050.1 | synonymous_variant ; p.Pro34Pro; LOW | synonymous_codon | Average:26.592; most accessible tissue: Minghui63 young leaf, score: 35.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003073690 | 1.33E-06 | NA | mr1538 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003073690 | 1.01E-06 | 2.28E-08 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003073690 | 4.86E-12 | 5.12E-12 | mr1547 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003073690 | 9.42E-09 | 1.72E-10 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003073690 | 2.62E-10 | 2.20E-12 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003073690 | 8.54E-10 | 9.51E-11 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003073690 | NA | 5.75E-08 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003073690 | 2.16E-09 | 1.12E-11 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003073690 | 5.70E-09 | 1.72E-12 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003073690 | 9.77E-11 | 3.08E-13 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003073690 | 1.29E-09 | 5.30E-11 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |