\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003072838:

Variant ID: vg1003072838 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3072838
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, C: 0.23, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGGTTAGATTTTGACGTTGATTCAGATTATATAAGATATCTACCACTCTATGAAACTTCCAGCGGCTTGATTTTCTAGATATTGTTCTTCTTTTCATA[T/C]
TTAATGCTGCATCAGTTGAGTTTGATCTATTAAGTCGTGCTTAGAATATCAATCTCTAGCCTGCCTTCTGGTTGCCGATTAGGGTAGCATCAGAGTTTCA

Reverse complement sequence

TGAAACTCTGATGCTACCCTAATCGGCAACCAGAAGGCAGGCTAGAGATTGATATTCTAAGCACGACTTAATAGATCAAACTCAACTGATGCAGCATTAA[A/G]
TATGAAAAGAAGAACAATATCTAGAAAATCAAGCCGCTGGAAGTTTCATAGAGTGGTAGATATCTTATATAATCTGAATCAACGTCAAAATCTAACCTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 47.80% 0.15% 0.00% NA
All Indica  2759 44.20% 55.60% 0.18% 0.00% NA
All Japonica  1512 74.70% 25.20% 0.07% 0.00% NA
Aus  269 6.70% 93.30% 0.00% 0.00% NA
Indica I  595 46.60% 53.40% 0.00% 0.00% NA
Indica II  465 27.50% 72.30% 0.22% 0.00% NA
Indica III  913 59.70% 40.00% 0.33% 0.00% NA
Indica Intermediate  786 34.20% 65.60% 0.13% 0.00% NA
Temperate Japonica  767 61.90% 37.90% 0.13% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003072838 T -> C LOC_Os10g06050.1 upstream_gene_variant ; 751.0bp to feature; MODIFIER silent_mutation Average:32.466; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N
vg1003072838 T -> C LOC_Os10g06030-LOC_Os10g06050 intergenic_region ; MODIFIER silent_mutation Average:32.466; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003072838 NA 5.02E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 NA 7.54E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 NA 7.39E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 1.39E-09 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 4.11E-14 3.19E-16 mr1538 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 7.70E-19 2.49E-18 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 4.16E-19 4.13E-25 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 NA 3.58E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 NA 8.58E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 3.91E-32 1.02E-54 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 7.43E-36 2.37E-63 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 NA 2.61E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 NA 2.22E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 NA 3.37E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 NA 6.41E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 NA 4.01E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 2.91E-07 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 3.78E-11 2.81E-17 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 1.99E-14 1.87E-20 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 4.59E-17 2.09E-24 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 1.66E-53 4.35E-102 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 4.15E-46 3.39E-102 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003072838 8.14E-10 2.62E-17 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251