\
| Variant ID: vg1003043919 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3043919 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, C: 0.31, others allele: 0.00, population size: 96. )
GAAGGGAAAATGACGAGTAGAAGACATGTATTTGGGTAGTTCCATAATGCACACAGTAGAAATCATTTGTCAGAATCAGTGTTTTGGCAGAAAAGGTAGA[A/C]
GAACGCAGAGTACTCTGCATTTTGTAATATAGGCATTGGACTAGCATAGAATATTAGAATCGATAGTCTCAGGATTGGTGATTGCATTAGTACATTGGAA
TTCCAATGTACTAATGCAATCACCAATCCTGAGACTATCGATTCTAATATTCTATGCTAGTCCAATGCCTATATTACAAAATGCAGAGTACTCTGCGTTC[T/G]
TCTACCTTTTCTGCCAAAACACTGATTCTGACAAATGATTTCTACTGTGTGCATTATGGAACTACCCAAATACATGTCTTCTACTCGTCATTTTCCCTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.90% | 28.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 67.40% | 32.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 76.30% | 23.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.00% | 34.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 69.20% | 30.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.70% | 24.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 58.40% | 41.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 62.30% | 37.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 40.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003043919 | A -> C | LOC_Os10g06010.1 | downstream_gene_variant ; 2551.0bp to feature; MODIFIER | silent_mutation | Average:59.61; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg1003043919 | A -> C | LOC_Os10g06000-LOC_Os10g06010 | intergenic_region ; MODIFIER | silent_mutation | Average:59.61; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003043919 | NA | 2.33E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 6.43E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 6.87E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | 1.56E-07 | 7.87E-09 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 4.11E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 1.08E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 4.94E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | 5.96E-09 | 2.70E-15 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | 6.29E-08 | 1.84E-12 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 9.60E-06 | mr1922 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 6.31E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 6.20E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 9.62E-08 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 3.79E-06 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | NA | 2.76E-06 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | 1.48E-17 | 9.93E-30 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | 4.08E-14 | 4.06E-21 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003043919 | 6.36E-06 | 1.50E-13 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |