\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003026779:

Variant ID: vg1003026779 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3026779
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTTACCAGATCTTTGATCACATAGGACAGGTTACCACTATTGTGTAGCTCAAGTATGTCTCAAGCCCATCTCACTCGATGCATTGTCTGTCACAAAC[C/A]
CGTATGGCTGGTCCATATAGCTCACCTCCTCCAACTCCCCATTAAGAAAAGTTGTTTCAACGTCCATCTGATGAACGATAAGACCATAAGAGGCTACCAG

Reverse complement sequence

CTGGTAGCCTCTTATGGTCTTATCGTTCATCAGATGGACGTTGAAACAACTTTTCTTAATGGGGAGTTGGAGGAGGTGAGCTATATGGACCAGCCATACG[G/T]
GTTTGTGACAGACAATGCATCGAGTGAGATGGGCTTGAGACATACTTGAGCTACACAATAGTGGTAACCTGTCCTATGTGATCAAAGATCTGGTAAATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 44.90% 0.30% 0.59% NA
All Indica  2759 78.90% 19.60% 0.47% 1.01% NA
All Japonica  1512 3.50% 96.50% 0.00% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 81.00% 18.50% 0.50% 0.00% NA
Indica II  465 85.80% 13.30% 0.65% 0.22% NA
Indica III  913 72.90% 24.30% 0.44% 2.30% NA
Indica Intermediate  786 80.20% 18.70% 0.38% 0.76% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 4.80% 95.20% 0.00% 0.00% NA
Japonica Intermediate  241 9.10% 90.90% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003026779 C -> A LOC_Os10g06000.1 upstream_gene_variant ; 4838.0bp to feature; MODIFIER silent_mutation Average:39.393; most accessible tissue: Callus, score: 63.164 N N N N
vg1003026779 C -> A LOC_Os10g05990.1 downstream_gene_variant ; 4642.0bp to feature; MODIFIER silent_mutation Average:39.393; most accessible tissue: Callus, score: 63.164 N N N N
vg1003026779 C -> A LOC_Os10g05990.2 downstream_gene_variant ; 4642.0bp to feature; MODIFIER silent_mutation Average:39.393; most accessible tissue: Callus, score: 63.164 N N N N
vg1003026779 C -> A LOC_Os10g05990-LOC_Os10g06000 intergenic_region ; MODIFIER silent_mutation Average:39.393; most accessible tissue: Callus, score: 63.164 N N N N
vg1003026779 C -> DEL N N silent_mutation Average:39.393; most accessible tissue: Callus, score: 63.164 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003026779 NA 6.43E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 NA 1.87E-06 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 NA 2.17E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 5.32E-11 NA mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 2.46E-11 1.53E-11 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 NA 1.95E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 NA 1.15E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 NA 1.44E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 NA 4.73E-09 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 2.92E-08 1.15E-10 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 2.35E-12 NA mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 3.29E-12 7.20E-11 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003026779 NA 7.31E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251