Variant ID: vg1003026779 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 3026779 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAATTTACCAGATCTTTGATCACATAGGACAGGTTACCACTATTGTGTAGCTCAAGTATGTCTCAAGCCCATCTCACTCGATGCATTGTCTGTCACAAAC[C/A]
CGTATGGCTGGTCCATATAGCTCACCTCCTCCAACTCCCCATTAAGAAAAGTTGTTTCAACGTCCATCTGATGAACGATAAGACCATAAGAGGCTACCAG
CTGGTAGCCTCTTATGGTCTTATCGTTCATCAGATGGACGTTGAAACAACTTTTCTTAATGGGGAGTTGGAGGAGGTGAGCTATATGGACCAGCCATACG[G/T]
GTTTGTGACAGACAATGCATCGAGTGAGATGGGCTTGAGACATACTTGAGCTACACAATAGTGGTAACCTGTCCTATGTGATCAAAGATCTGGTAAATTA
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 54.20% | 44.90% | 0.30% | 0.59% | NA |
All Indica | 2759 | 78.90% | 19.60% | 0.47% | 1.01% | NA |
All Japonica | 1512 | 3.50% | 96.50% | 0.00% | 0.00% | NA |
Aus | 269 | 80.30% | 19.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 81.00% | 18.50% | 0.50% | 0.00% | NA |
Indica II | 465 | 85.80% | 13.30% | 0.65% | 0.22% | NA |
Indica III | 913 | 72.90% | 24.30% | 0.44% | 2.30% | NA |
Indica Intermediate | 786 | 80.20% | 18.70% | 0.38% | 0.76% | NA |
Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 9.10% | 90.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 75.00% | 25.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 50.00% | 48.90% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1003026779 | C -> A | LOC_Os10g06000.1 | upstream_gene_variant ; 4838.0bp to feature; MODIFIER | silent_mutation | Average:39.393; most accessible tissue: Callus, score: 63.164 | N | N | N | N |
vg1003026779 | C -> A | LOC_Os10g05990.1 | downstream_gene_variant ; 4642.0bp to feature; MODIFIER | silent_mutation | Average:39.393; most accessible tissue: Callus, score: 63.164 | N | N | N | N |
vg1003026779 | C -> A | LOC_Os10g05990.2 | downstream_gene_variant ; 4642.0bp to feature; MODIFIER | silent_mutation | Average:39.393; most accessible tissue: Callus, score: 63.164 | N | N | N | N |
vg1003026779 | C -> A | LOC_Os10g05990-LOC_Os10g06000 | intergenic_region ; MODIFIER | silent_mutation | Average:39.393; most accessible tissue: Callus, score: 63.164 | N | N | N | N |
vg1003026779 | C -> DEL | N | N | silent_mutation | Average:39.393; most accessible tissue: Callus, score: 63.164 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1003026779 | NA | 6.43E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | NA | 1.87E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | NA | 2.17E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | 5.32E-11 | NA | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | 2.46E-11 | 1.53E-11 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | NA | 1.95E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | NA | 1.15E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | NA | 1.44E-15 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | NA | 4.73E-09 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | 2.92E-08 | 1.15E-10 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | 2.35E-12 | NA | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | 3.29E-12 | 7.20E-11 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1003026779 | NA | 7.31E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |