\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003025097:

Variant ID: vg1003025097 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3025097
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACCTCCTCGAGCTCAACTAATTATATACCCGATTTTAGGCTAATGTTTACTCTTAATTAAGCAATGAACCTAGATGTAAGAAATTACGCGTGTTCACT[C/G]
TTAGAATTTTATATGATAATAGTAGAAATAACAAGATATGTAGATAGGTAGACAACATAACTTCATATGCTTCATTTATATAAATTTTATCTTTGATCGA

Reverse complement sequence

TCGATCAAAGATAAAATTTATATAAATGAAGCATATGAAGTTATGTTGTCTACCTATCTACATATCTTGTTATTTCTACTATTATCATATAAAATTCTAA[G/C]
AGTGAACACGCGTAATTTCTTACATCTAGGTTCATTGCTTAATTAAGAGTAAACATTAGCCTAAAATCGGGTATATAATTAGTTGAGCTCGAGGAGGTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 27.70% 0.02% 0.17% NA
All Indica  2759 95.60% 4.10% 0.04% 0.29% NA
All Japonica  1512 24.80% 75.20% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 89.90% 9.30% 0.11% 0.66% NA
Indica Intermediate  786 97.10% 2.70% 0.00% 0.25% NA
Temperate Japonica  767 38.10% 61.90% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 94.20% 0.00% 0.00% NA
Japonica Intermediate  241 22.40% 77.60% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003025097 C -> G LOC_Os10g05990.1 downstream_gene_variant ; 2960.0bp to feature; MODIFIER silent_mutation Average:36.293; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg1003025097 C -> G LOC_Os10g05990.2 downstream_gene_variant ; 2960.0bp to feature; MODIFIER silent_mutation Average:36.293; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg1003025097 C -> G LOC_Os10g05990-LOC_Os10g06000 intergenic_region ; MODIFIER silent_mutation Average:36.293; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg1003025097 C -> DEL N N silent_mutation Average:36.293; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003025097 NA 5.18E-17 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 1.37E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 7.50E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 7.66E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 4.72E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 2.40E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 3.20E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 3.29E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 8.91E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 4.94E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 5.98E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 6.66E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 4.16E-21 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 8.56E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 7.94E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 7.55E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 2.46E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 7.90E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 1.13E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 5.57E-14 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 8.85E-11 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 7.54E-12 mr1765_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 2.65E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003025097 NA 5.06E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251