| Variant ID: vg1003008433 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3008433 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGAAATAAAGTTAAATTTGAGTTGTTTTGTTGATAGGTATAAGTATGAATCGAATTATTATAACTAGGTATATACTCACAATTTGAAAATTTTAAAAAA[A/T]
TTGAGTGATTTTGTGCATTAGATAGCATGGTGCCCGGGCACTATGGTGCCCCATATGAGTGCGTATATATATATCAGGTTGAATGCTCCATCAAGCGACC
GGTCGCTTGATGGAGCATTCAACCTGATATATATATACGCACTCATATGGGGCACCATAGTGCCCGGGCACCATGCTATCTAATGCACAAAATCACTCAA[T/A]
TTTTTTAAAATTTTCAAATTGTGAGTATATACCTAGTTATAATAATTCGATTCATACTTATACCTATCAACAAAACAACTCAAATTTAACTTTATTTCAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.30% | 4.00% | 1.21% | 16.53% | NA |
| All Indica | 2759 | 88.30% | 2.10% | 1.52% | 8.12% | NA |
| All Japonica | 1512 | 75.50% | 3.10% | 0.79% | 20.63% | NA |
| Aus | 269 | 8.20% | 8.90% | 1.12% | 81.78% | NA |
| Indica I | 595 | 98.20% | 0.00% | 0.34% | 1.51% | NA |
| Indica II | 465 | 71.20% | 0.20% | 2.15% | 26.45% | NA |
| Indica III | 913 | 90.60% | 4.90% | 2.41% | 2.08% | NA |
| Indica Intermediate | 786 | 88.30% | 1.40% | 1.02% | 9.29% | NA |
| Temperate Japonica | 767 | 64.40% | 1.00% | 1.56% | 32.99% | NA |
| Tropical Japonica | 504 | 95.80% | 1.00% | 0.00% | 3.17% | NA |
| Japonica Intermediate | 241 | 68.00% | 14.10% | 0.00% | 17.84% | NA |
| VI/Aromatic | 96 | 39.60% | 52.10% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 70.00% | 11.10% | 0.00% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003008433 | A -> T | LOC_Os10g05960.1 | upstream_gene_variant ; 4246.0bp to feature; MODIFIER | silent_mutation | Average:31.402; most accessible tissue: Zhenshan97 root, score: 39.742 | N | N | N | N |
| vg1003008433 | A -> T | LOC_Os10g05970.1 | downstream_gene_variant ; 4263.0bp to feature; MODIFIER | silent_mutation | Average:31.402; most accessible tissue: Zhenshan97 root, score: 39.742 | N | N | N | N |
| vg1003008433 | A -> T | LOC_Os10g05970.2 | downstream_gene_variant ; 4263.0bp to feature; MODIFIER | silent_mutation | Average:31.402; most accessible tissue: Zhenshan97 root, score: 39.742 | N | N | N | N |
| vg1003008433 | A -> T | LOC_Os10g05960-LOC_Os10g05970 | intergenic_region ; MODIFIER | silent_mutation | Average:31.402; most accessible tissue: Zhenshan97 root, score: 39.742 | N | N | N | N |
| vg1003008433 | A -> DEL | N | N | silent_mutation | Average:31.402; most accessible tissue: Zhenshan97 root, score: 39.742 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003008433 | 2.08E-06 | NA | mr1160_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003008433 | 8.21E-06 | NA | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003008433 | 7.76E-06 | NA | mr1477_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003008433 | 4.75E-07 | 1.55E-08 | mr1522_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003008433 | 1.99E-06 | 2.92E-06 | mr1522_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |