Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003006014:

Variant ID: vg1003006014 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 3006014
Reference Allele: TA	Alternative Allele: AA,T
Primary Allele: AA	Secondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTCAGTACTATCACCCACATGTATGGATCTACTCCTAGCAAATGGTTTTGAAGTTTTTTTTACGCAATCCATGCGTGTCTGCCGAAGGAAGATGAGTTC[TA/AA,T]
GCCATTAATCGATCCCTCAAGGGAATGATATGTGTATTTTCTTTCTCAAATGTAATGCAAACTGTTACGATATTTTTTTACAAAACTAGAAAGGTAGCCC

Reverse complement sequence

GGGCTACCTTTCTAGTTTTGTAAAAAAATATCGTAACAGTTTGCATTACATTTGAGAAAGAAAATACACATATCATTCCCTTGAGGGATCGATTAATGGC[TA/TT,A]
GAACTCATCTTCCTTCGGCAGACACGCATGGATTGCGTAAAAAAAACTTCAAAACCATTTGCTAGGAGTAGATCCATACATGTGGGTGATAGTACTGAGG

Allele Frequencies:

Populations	Population Size	Frequency of AA(primary allele)	Frequency of TA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.20%	29.50%	0.23%	0.00%	T: 19.04%
All Indica	2759	84.80%	3.70%	0.22%	0.00%	T: 11.31%
All Japonica	1512	1.60%	76.00%	0.20%	0.00%	T: 22.22%
Aus	269	2.60%	14.10%	0.37%	0.00%	T: 82.90%
Indica I	595	97.50%	0.50%	0.17%	0.00%	T: 1.85%
Indica II	465	69.50%	1.70%	0.22%	0.00%	T: 28.60%
Indica III	913	84.00%	6.70%	0.00%	0.00%	T: 9.31%
Indica Intermediate	786	85.10%	3.80%	0.51%	0.00%	T: 10.56%
Temperate Japonica	767	0.70%	63.20%	0.26%	0.00%	T: 35.85%
Tropical Japonica	504	2.60%	94.20%	0.00%	0.00%	T: 3.17%
Japonica Intermediate	241	2.50%	78.40%	0.41%	0.00%	T: 18.67%
VI/Aromatic	96	25.00%	66.70%	0.00%	0.00%	T: 8.33%
Intermediate	90	30.00%	45.60%	1.11%	0.00%	T: 23.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003006014	TA -> AA	LOC_Os10g05950.1	upstream_gene_variant ; 4760.0bp to feature; MODIFIER	silent_mutation	Average:53.143; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1003006014	TA -> AA	LOC_Os10g05960.1	upstream_gene_variant ; 1827.0bp to feature; MODIFIER	silent_mutation	Average:53.143; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1003006014	TA -> AA	LOC_Os10g05960-LOC_Os10g05970	intergenic_region ; MODIFIER	silent_mutation	Average:53.143; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1003006014	TA -> T	LOC_Os10g05950.1	upstream_gene_variant ; 4761.0bp to feature; MODIFIER	silent_mutation	Average:53.143; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1003006014	TA -> T	LOC_Os10g05960.1	upstream_gene_variant ; 1828.0bp to feature; MODIFIER	silent_mutation	Average:53.143; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1003006014	TA -> T	LOC_Os10g05960-LOC_Os10g05970	intergenic_region ; MODIFIER	silent_mutation	Average:53.143; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003006014	NA	1.04E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003006014	NA	7.97E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003006014	NA	9.28E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003006014	NA	4.64E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003006014	3.62E-06	NA	mr1962_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251