\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003005565:

Variant ID: vg1003005565 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3005565
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGGGTTATTTGTTCGGTATGAAAAGTTTGGGGTGTAGAATATTTGGTTTTGTAGCTTATGGGGTAATTCATACTAGCTTAATAGTTCAGGAGGTAATT[C/T]
ATACTTTTTCCTTGTATAAAAGCCCAAATAACTAAATAATTAAATAATGTCTTTATAATGCAACATAATTTCTGTGATAAATATGAAAAATCGAATTATG

Reverse complement sequence

CATAATTCGATTTTTCATATTTATCACAGAAATTATGTTGCATTATAAAGACATTATTTAATTATTTAGTTATTTGGGCTTTTATACAAGGAAAAAGTAT[G/A]
AATTACCTCCTGAACTATTAAGCTAGTATGAATTACCCCATAAGCTACAAAACCAAATATTCTACACCCCAAACTTTTCATACCGAACAAATAACCCCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 0.20% 1.78% 16.84% NA
All Indica  2759 88.60% 0.10% 2.28% 8.99% NA
All Japonica  1512 78.60% 0.30% 1.32% 19.78% NA
Aus  269 17.10% 0.00% 0.00% 82.90% NA
Indica I  595 98.20% 0.00% 0.00% 1.85% NA
Indica II  465 71.00% 0.00% 0.00% 29.03% NA
Indica III  913 90.80% 0.30% 6.46% 2.41% NA
Indica Intermediate  786 89.30% 0.00% 0.51% 10.18% NA
Temperate Japonica  767 65.70% 0.40% 2.09% 31.81% NA
Tropical Japonica  504 96.80% 0.00% 0.20% 2.98% NA
Japonica Intermediate  241 81.70% 0.40% 1.24% 16.60% NA
VI/Aromatic  96 91.70% 0.00% 0.00% 8.33% NA
Intermediate  90 77.80% 1.10% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003005565 C -> T LOC_Os10g05950.1 upstream_gene_variant ; 4311.0bp to feature; MODIFIER silent_mutation Average:40.122; most accessible tissue: Callus, score: 65.104 N N N N
vg1003005565 C -> T LOC_Os10g05960.1 upstream_gene_variant ; 1378.0bp to feature; MODIFIER silent_mutation Average:40.122; most accessible tissue: Callus, score: 65.104 N N N N
vg1003005565 C -> T LOC_Os10g05960-LOC_Os10g05970 intergenic_region ; MODIFIER silent_mutation Average:40.122; most accessible tissue: Callus, score: 65.104 N N N N
vg1003005565 C -> DEL N N silent_mutation Average:40.122; most accessible tissue: Callus, score: 65.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003005565 NA 4.68E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565 3.50E-07 NA mr1219 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565 NA 7.60E-06 mr1219 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565 NA 6.15E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565 NA 4.22E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565 NA 3.39E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003005565 NA 8.08E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251