\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003004399:

Variant ID: vg1003004399 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3004399
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


GAATTTTATATGGAAAAACCCTTGTGGGAAAAAACCACGGGCGCCGACCAGCAATGATCACTATAGAGGAATTGGATACAAACGCAGGGGATACATTGGG[T/C]
TGTCGCACCCTCCCCGTGCGGCTTACAAGGGATATATATATGAGAAATCTAGAAGTCCTAGTGGGGGAAAGACTTAGAGTCATACTAGGAAACTAATCCT

Reverse complement sequence

AGGATTAGTTTCCTAGTATGACTCTAAGTCTTTCCCCCACTAGGACTTCTAGATTTCTCATATATATATCCCTTGTAAGCCGCACGGGGAGGGTGCGACA[A/G]
CCCAATGTATCCCCTGCGTTTGTATCCAATTCCTCTATAGTGATCATTGCTGGTCGGCGCCCGTGGTTTTTTCCCACAAGGGTTTTTCCATATAAAATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 31.70% 13.44% 10.88% NA
All Indica  2759 71.40% 5.40% 16.20% 7.00% NA
All Japonica  1512 1.50% 77.70% 1.39% 19.38% NA
Aus  269 13.40% 23.40% 56.13% 7.06% NA
Indica I  595 77.50% 1.00% 14.45% 7.06% NA
Indica II  465 57.00% 6.70% 28.17% 8.17% NA
Indica III  913 74.50% 7.10% 11.61% 6.79% NA
Indica Intermediate  786 71.90% 5.90% 15.78% 6.49% NA
Temperate Japonica  767 0.70% 65.40% 1.43% 32.46% NA
Tropical Japonica  504 2.40% 95.20% 0.99% 1.39% NA
Japonica Intermediate  241 2.50% 80.10% 2.07% 15.35% NA
VI/Aromatic  96 25.00% 69.80% 2.08% 3.12% NA
Intermediate  90 28.90% 48.90% 15.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003004399 T -> C LOC_Os10g05950.1 upstream_gene_variant ; 3145.0bp to feature; MODIFIER silent_mutation Average:60.997; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg1003004399 T -> C LOC_Os10g05960.1 upstream_gene_variant ; 212.0bp to feature; MODIFIER silent_mutation Average:60.997; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg1003004399 T -> C LOC_Os10g05960-LOC_Os10g05970 intergenic_region ; MODIFIER silent_mutation Average:60.997; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N
vg1003004399 T -> DEL N N silent_mutation Average:60.997; most accessible tissue: Zhenshan97 flag leaf, score: 77.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003004399 NA 3.57E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003004399 1.23E-07 1.27E-07 mr1768 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003004399 NA 3.18E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251