Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003004399:

Variant ID: vg1003004399 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3004399
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

GAATTTTATATGGAAAAACCCTTGTGGGAAAAAACCACGGGCGCCGACCAGCAATGATCACTATAGAGGAATTGGATACAAACGCAGGGGATACATTGGG[T/C]
TGTCGCACCCTCCCCGTGCGGCTTACAAGGGATATATATATGAGAAATCTAGAAGTCCTAGTGGGGGAAAGACTTAGAGTCATACTAGGAAACTAATCCT

Reverse complement sequence

AGGATTAGTTTCCTAGTATGACTCTAAGTCTTTCCCCCACTAGGACTTCTAGATTTCTCATATATATATCCCTTGTAAGCCGCACGGGGAGGGTGCGACA[A/G]
CCCAATGTATCCCCTGCGTTTGTATCCAATTCCTCTATAGTGATCATTGCTGGTCGGCGCCCGTGGTTTTTTCCCACAAGGGTTTTTCCATATAAAATTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.00%	31.70%	13.44%	10.88%	NA
All Indica	2759	71.40%	5.40%	16.20%	7.00%	NA
All Japonica	1512	1.50%	77.70%	1.39%	19.38%	NA
Aus	269	13.40%	23.40%	56.13%	7.06%	NA
Indica I	595	77.50%	1.00%	14.45%	7.06%	NA
Indica II	465	57.00%	6.70%	28.17%	8.17%	NA
Indica III	913	74.50%	7.10%	11.61%	6.79%	NA
Indica Intermediate	786	71.90%	5.90%	15.78%	6.49%	NA
Temperate Japonica	767	0.70%	65.40%	1.43%	32.46%	NA
Tropical Japonica	504	2.40%	95.20%	0.99%	1.39%	NA
Japonica Intermediate	241	2.50%	80.10%	2.07%	15.35%	NA
VI/Aromatic	96	25.00%	69.80%	2.08%	3.12%	NA
Intermediate	90	28.90%	48.90%	15.56%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003004399	T -> C	LOC_Os10g05950.1	upstream_gene_variant ; 3145.0bp to feature; MODIFIER	silent_mutation	Average:60.997; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg1003004399	T -> C	LOC_Os10g05960.1	upstream_gene_variant ; 212.0bp to feature; MODIFIER	silent_mutation	Average:60.997; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg1003004399	T -> C	LOC_Os10g05960-LOC_Os10g05970	intergenic_region ; MODIFIER	silent_mutation	Average:60.997; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg1003004399	T -> DEL	N	N	silent_mutation	Average:60.997; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003004399	NA	3.57E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003004399	1.23E-07	1.27E-07	mr1768	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003004399	NA	3.18E-06	mr1768_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251