\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002992765:

Variant ID: vg1002992765 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2992765
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.08, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


CCACCTACTAGTGAGTCCCGACTCTCTTCCTTGACCCATCCTCAATCCTCATCACCGGCGTTGTTCATCTCCGCTTAGCTAGCATGAGCACCGTCAGCCC[T/C]
GCCGCATCTTCACTGTGCTCTCCCCTTTCTTTTCCGCCACCGTTCCTATAAGCACTACTAGAAAAATGATTTTTCATGCGGTTGGCATATTATTTTAGCC

Reverse complement sequence

GGCTAAAATAATATGCCAACCGCATGAAAAATCATTTTTCTAGTAGTGCTTATAGGAACGGTGGCGGAAAAGAAAGGGGAGAGCACAGTGAAGATGCGGC[A/G]
GGGCTGACGGTGCTCATGCTAGCTAAGCGGAGATGAACAACGCCGGTGATGAGGATTGAGGATGGGTCAAGGAAGAGAGTCGGGACTCACTAGTAGGTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.30% 19.90% 0.44% 54.30% NA
All Indica  2759 1.80% 10.30% 0.58% 87.28% NA
All Japonica  1512 72.20% 26.30% 0.13% 1.46% NA
Aus  269 3.70% 84.40% 0.00% 11.90% NA
Indica I  595 0.30% 2.50% 0.50% 96.64% NA
Indica II  465 1.70% 30.50% 0.22% 67.53% NA
Indica III  913 2.10% 3.60% 0.99% 93.32% NA
Indica Intermediate  786 2.70% 12.10% 0.38% 84.86% NA
Temperate Japonica  767 61.80% 37.50% 0.00% 0.65% NA
Tropical Japonica  504 91.70% 5.40% 0.40% 2.58% NA
Japonica Intermediate  241 64.30% 34.00% 0.00% 1.66% NA
VI/Aromatic  96 14.60% 12.50% 0.00% 72.92% NA
Intermediate  90 35.60% 23.30% 3.33% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002992765 T -> C LOC_Os10g05940.1 upstream_gene_variant ; 2631.0bp to feature; MODIFIER silent_mutation Average:45.824; most accessible tissue: Callus, score: 71.022 N N N N
vg1002992765 T -> C LOC_Os10g05930.1 downstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:45.824; most accessible tissue: Callus, score: 71.022 N N N N
vg1002992765 T -> C LOC_Os10g05930-LOC_Os10g05940 intergenic_region ; MODIFIER silent_mutation Average:45.824; most accessible tissue: Callus, score: 71.022 N N N N
vg1002992765 T -> DEL N N silent_mutation Average:45.824; most accessible tissue: Callus, score: 71.022 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002992765 NA 8.63E-06 mr1059 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 1.09E-19 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 6.11E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 3.63E-06 mr1143 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 8.99E-06 mr1167 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 8.83E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 7.73E-12 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 1.33E-06 1.15E-18 mr1324 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 2.12E-12 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 6.08E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 3.59E-06 1.57E-15 mr1335 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 9.79E-07 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 4.31E-08 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 6.62E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 4.75E-06 mr1535 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 1.78E-14 mr1553 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 1.64E-11 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 2.99E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 9.11E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 1.44E-13 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 2.97E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 8.86E-09 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 6.85E-07 NA mr1732 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 3.80E-06 NA mr1732 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 4.86E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 1.80E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 9.70E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 2.97E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 6.04E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 4.17E-06 mr1995 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 1.64E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 3.77E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 8.12E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 4.18E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 7.71E-06 5.80E-12 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 1.51E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002992765 NA 2.46E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251