\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002966355:

Variant ID: vg1002966355 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 2966355
Reference Allele: AGAlternative Allele: GG,A
Primary Allele: AGSecondary Allele: GG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTTCGTGGCTTTAGGCTGCCTACCTCATGTATAAATAGAGGGGGAGCGTGAGGCTTCCCGGTATCGCTTTAGAGAGCAATAGAATTGAGTTTTGAGTT[AG/GG,A]
GGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGTTGTTGGTGCACTTTGTAAACATAGAGAGAATTAATAAAGTCGTCATTCACTTTAAGAGTTCTTC

Reverse complement sequence

GAAGAACTCTTAAAGTGAATGACGACTTTATTAATTCTCTCTATGTTTACAAAGTGCACCAACAACACTCCTTACAAAAATTTCGACTAAACTCGAAACC[CT/CC,T]
AACTCAAAACTCAATTCTATTGCTCTCTAAAGCGATACCGGGAAGCCTCACGCTCCCCCTCTATTTATACATGAGGTAGGCAGCCTAAAGCCACGAACCA

Allele Frequencies:

Populations Population SizeFrequency of AG(primary allele) Frequency of GG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 8.30% 2.73% 1.27% A: 0.02%
All Indica  2759 96.40% 0.60% 0.83% 2.10% A: 0.04%
All Japonica  1512 71.90% 22.30% 5.75% 0.07% NA
Aus  269 86.20% 10.00% 3.72% 0.00% NA
Indica I  595 98.30% 0.00% 0.50% 1.18% NA
Indica II  465 98.90% 0.00% 0.65% 0.43% NA
Indica III  913 94.90% 0.70% 1.10% 3.29% A: 0.11%
Indica Intermediate  786 95.40% 1.30% 0.89% 2.42% NA
Temperate Japonica  767 93.60% 5.00% 1.43% 0.00% NA
Tropical Japonica  504 38.50% 49.00% 12.50% 0.00% NA
Japonica Intermediate  241 72.60% 21.60% 5.39% 0.41% NA
VI/Aromatic  96 92.70% 4.20% 3.12% 0.00% NA
Intermediate  90 85.60% 6.70% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002966355 AG -> GG LOC_Os10g05870.1 downstream_gene_variant ; 256.0bp to feature; MODIFIER silent_mutation Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg1002966355 AG -> GG LOC_Os10g05880.1 downstream_gene_variant ; 565.0bp to feature; MODIFIER silent_mutation Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg1002966355 AG -> GG LOC_Os10g05890.1 downstream_gene_variant ; 4457.0bp to feature; MODIFIER silent_mutation Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg1002966355 AG -> GG LOC_Os10g05870-LOC_Os10g05880 intergenic_region ; MODIFIER silent_mutation Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg1002966355 AG -> A LOC_Os10g05870.1 downstream_gene_variant ; 257.0bp to feature; MODIFIER silent_mutation Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg1002966355 AG -> A LOC_Os10g05880.1 downstream_gene_variant ; 564.0bp to feature; MODIFIER silent_mutation Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg1002966355 AG -> A LOC_Os10g05890.1 downstream_gene_variant ; 4456.0bp to feature; MODIFIER silent_mutation Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg1002966355 AG -> A LOC_Os10g05870-LOC_Os10g05880 intergenic_region ; MODIFIER silent_mutation Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N
vg1002966355 AG -> DEL N N silent_mutation Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002966355 NA 7.48E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 3.47E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 3.29E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 2.38E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 1.43E-06 1.43E-06 mr1208 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 7.28E-06 mr1239 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 2.47E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 6.37E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 7.19E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 2.64E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 4.68E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 9.89E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 2.29E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 3.90E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 2.22E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 9.95E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 6.15E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 1.29E-07 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 5.70E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355 NA 7.79E-07 mr1991 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251