Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002966355:

Variant ID: vg1002966355 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 2966355
Reference Allele: AG	Alternative Allele: GG,A
Primary Allele: AG	Secondary Allele: GG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGTTCGTGGCTTTAGGCTGCCTACCTCATGTATAAATAGAGGGGGAGCGTGAGGCTTCCCGGTATCGCTTTAGAGAGCAATAGAATTGAGTTTTGAGTT[AG/GG,A]
GGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGTTGTTGGTGCACTTTGTAAACATAGAGAGAATTAATAAAGTCGTCATTCACTTTAAGAGTTCTTC

Reverse complement sequence

GAAGAACTCTTAAAGTGAATGACGACTTTATTAATTCTCTCTATGTTTACAAAGTGCACCAACAACACTCCTTACAAAAATTTCGACTAAACTCGAAACC[CT/CC,T]
AACTCAAAACTCAATTCTATTGCTCTCTAAAGCGATACCGGGAAGCCTCACGCTCCCCCTCTATTTATACATGAGGTAGGCAGCCTAAAGCCACGAACCA

Allele Frequencies:

Populations	Population Size	Frequency of AG(primary allele)	Frequency of GG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.70%	8.30%	2.73%	1.27%	A: 0.02%
All Indica	2759	96.40%	0.60%	0.83%	2.10%	A: 0.04%
All Japonica	1512	71.90%	22.30%	5.75%	0.07%	NA
Aus	269	86.20%	10.00%	3.72%	0.00%	NA
Indica I	595	98.30%	0.00%	0.50%	1.18%	NA
Indica II	465	98.90%	0.00%	0.65%	0.43%	NA
Indica III	913	94.90%	0.70%	1.10%	3.29%	A: 0.11%
Indica Intermediate	786	95.40%	1.30%	0.89%	2.42%	NA
Temperate Japonica	767	93.60%	5.00%	1.43%	0.00%	NA
Tropical Japonica	504	38.50%	49.00%	12.50%	0.00%	NA
Japonica Intermediate	241	72.60%	21.60%	5.39%	0.41%	NA
VI/Aromatic	96	92.70%	4.20%	3.12%	0.00%	NA
Intermediate	90	85.60%	6.70%	6.67%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002966355	AG -> GG	LOC_Os10g05870.1	downstream_gene_variant ; 256.0bp to feature; MODIFIER	silent_mutation	Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg1002966355	AG -> GG	LOC_Os10g05880.1	downstream_gene_variant ; 565.0bp to feature; MODIFIER	silent_mutation	Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg1002966355	AG -> GG	LOC_Os10g05890.1	downstream_gene_variant ; 4457.0bp to feature; MODIFIER	silent_mutation	Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg1002966355	AG -> GG	LOC_Os10g05870-LOC_Os10g05880	intergenic_region ; MODIFIER	silent_mutation	Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg1002966355	AG -> A	LOC_Os10g05870.1	downstream_gene_variant ; 257.0bp to feature; MODIFIER	silent_mutation	Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg1002966355	AG -> A	LOC_Os10g05880.1	downstream_gene_variant ; 564.0bp to feature; MODIFIER	silent_mutation	Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg1002966355	AG -> A	LOC_Os10g05890.1	downstream_gene_variant ; 4456.0bp to feature; MODIFIER	silent_mutation	Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg1002966355	AG -> A	LOC_Os10g05870-LOC_Os10g05880	intergenic_region ; MODIFIER	silent_mutation	Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N
vg1002966355	AG -> DEL	N	N	silent_mutation	Average:12.088; most accessible tissue: Zhenshan97 flower, score: 19.853	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002966355	NA	7.48E-07	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	3.47E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	3.29E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	2.38E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	1.43E-06	1.43E-06	mr1208	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	7.28E-06	mr1239	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	2.47E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	6.37E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	7.19E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	2.64E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	4.68E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	9.89E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	2.29E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	3.90E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	2.22E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	9.95E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	6.15E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	1.29E-07	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	5.70E-06	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002966355	NA	7.79E-07	mr1991	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251