Search for Variation information by Variation ID:
Detailed information for vg1002966041:
| Variant ID: vg1002966041 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2966041 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CGGAATATGGTTTCTTTGTCTATTCCATGTGTAGGTGACTCGATGTCTCGGGAGAGTATTTACGGTGATGGACCGGGAGTTGGCTTGGGGATAAGACGAC[G/A]
TCCGTTGTGGTCAGAGATCATGCGGGATACTAAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCCATATGGCATACGATGGAGTTATTGTGTGCGTA
Reverse complement sequence
TACGCACACAATAACTCCATCGTATGCCATATGGAATCTCCATCAACCACGTGCATCAACTCTAGCCTTAGTATCCCGCATGATCTCTGACCACAACGGA[C/T]
GTCGTCTTATCCCCAAGCCAACTCCCGGTCCATCACCGTAAATACTCTCCCGAGACATCGAGTCACCTACACATGGAATAGACAAAGAAACCATATTCCG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.90% | 14.90% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.40% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 60.80% | 39.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 82.90% | 16.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.10% | 82.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.70% | 37.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002966041 | G -> A | LOC_Os10g05870.1 | missense_variant ; p.Arg136His; MODERATE | nonsynonymous_codon ; R136N | Average:11.805; most accessible tissue: Zhenshan97 panicle, score: 16.188 | benign  |
1.408 |
TOLERATED | 0.31 |
| vg1002966041 | G -> A | LOC_Os10g05870.1 | missense_variant ; p.Arg136His; MODERATE | nonsynonymous_codon ; R136Y | Average:11.805; most accessible tissue: Zhenshan97 panicle, score: 16.188 | probably damaging |
2.218 |
TOLERATED | 0.16 |
| vg1002966041 | G -> A | LOC_Os10g05870.1 | missense_variant ; p.Arg136His; MODERATE | nonsynonymous_codon ; R136H | Average:11.805; most accessible tissue: Zhenshan97 panicle, score: 16.188 | probably damaging |
2.37 |
TOLERATED | 0.18 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002966041 | NA | 9.84E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002966041 | NA | 7.06E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002966041 | NA | 5.15E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002966041 | NA | 5.88E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002966041 | 1.86E-06 | 2.43E-08 | mr1782 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002966041 | NA | 6.03E-08 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |