Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002961240:

Variant ID: vg1002961240 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2961240
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGCACCAACTGTATTCATGATTGGTCTGAGTTAGAACAAAAATATCATGATTACTTCTTTAATTAGTGGTGAGACCGAATTAAACTTGTCGTACTTAAC[C/A]
TCGGTTAAACAAAAGTATAACGAGCCTACTTTTGAATACATTAGAAGATTTATATATATAAGAAACTGATGTTATAGTTTAACACTTTCTGATAAGGTCT

Reverse complement sequence

AGACCTTATCAGAAAGTGTTAAACTATAACATCAGTTTCTTATATATATAAATCTTCTAATGTATTCAAAAGTAGGCTCGTTATACTTTTGTTTAACCGA[G/T]
GTTAAGTACGACAAGTTTAATTCGGTCTCACCACTAATTAAAGAAGTAATCATGATATTTTTGTTCTAACTCAGACCAATCATGAATACAGTTGGTGCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.10%	20.10%	0.42%	0.36%	NA
All Indica	2759	98.00%	1.40%	0.51%	0.07%	NA
All Japonica	1512	43.10%	55.70%	0.33%	0.93%	NA
Aus	269	88.10%	11.90%	0.00%	0.00%	NA
Indica I	595	96.50%	2.40%	1.01%	0.17%	NA
Indica II	465	97.80%	1.30%	0.86%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	97.30%	2.20%	0.38%	0.13%	NA
Temperate Japonica	767	11.70%	86.70%	0.65%	0.91%	NA
Tropical Japonica	504	92.30%	7.10%	0.00%	0.60%	NA
Japonica Intermediate	241	39.80%	58.50%	0.00%	1.66%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	68.90%	28.90%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002961240	C -> A	LOC_Os10g05860.1	upstream_gene_variant ; 1211.0bp to feature; MODIFIER	silent_mutation	Average:21.02; most accessible tissue: Callus, score: 48.63	N	N	N	N
vg1002961240	C -> A	LOC_Os10g05870.1	upstream_gene_variant ; 631.0bp to feature; MODIFIER	silent_mutation	Average:21.02; most accessible tissue: Callus, score: 48.63	N	N	N	N
vg1002961240	C -> A	LOC_Os10g05860-LOC_Os10g05870	intergenic_region ; MODIFIER	silent_mutation	Average:21.02; most accessible tissue: Callus, score: 48.63	N	N	N	N
vg1002961240	C -> DEL	N	N	silent_mutation	Average:21.02; most accessible tissue: Callus, score: 48.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002961240	NA	6.24E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.21E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	7.32E-07	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	2.99E-07	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	6.93E-24	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	7.40E-39	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	4.78E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	3.22E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	4.14E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	4.06E-07	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	2.17E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.95E-15	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	9.84E-12	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	3.44E-22	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.47E-10	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	5.32E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.99E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.05E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.19E-12	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	5.65E-17	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	8.87E-06	8.87E-06	mr1736	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	2.88E-08	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	4.85E-13	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.44E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	1.44E-08	9.28E-23	mr1768	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	2.52E-06	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.12E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.65E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	9.23E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	5.67E-43	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	5.55E-06	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	7.43E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	5.81E-15	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	5.45E-07	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	3.12E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.01E-33	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	2.46E-08	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	6.48E-22	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	6.79E-08	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	8.42E-27	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	1.99E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002961240	NA	2.21E-14	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251