Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1002954217:

Variant ID: vg1002954217 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2954217
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

AAATTAAATGTGAAATGATACTGTGTGCGGGTCCCACCTGTCAGTCTCTTTCTCTCTTCTCTTCTTCAACCTCTAGCCGTTCCCCATTTACGGCCGGCGG[T/C]
GCTAGGGTTAGCGATTTCGGCGGTGATAGAGGGGGAAAGGGGGTTGCGGCCGAGGAGGGGAGGTAGCTAGGGTTCTCCGGCGACGGCGAGTGGCGGCGGA

Reverse complement sequence

TCCGCCGCCACTCGCCGTCGCCGGAGAACCCTAGCTACCTCCCCTCCTCGGCCGCAACCCCCTTTCCCCCTCTATCACCGCCGAAATCGCTAACCCTAGC[A/G]
CCGCCGGCCGTAAATGGGGAACGGCTAGAGGTTGAAGAAGAGAAGAGAGAAAGAGACTGACAGGTGGGACCCGCACACAGTATCATTTCACATTTAATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.10%	21.60%	2.71%	47.63%	NA
All Indica	2759	37.20%	2.90%	4.13%	55.82%	NA
All Japonica	1512	3.80%	57.40%	0.40%	38.36%	NA
Aus	269	77.70%	12.30%	0.37%	9.67%	NA
Indica I	595	9.10%	4.50%	3.87%	82.52%	NA
Indica II	465	63.70%	2.20%	2.80%	31.40%	NA
Indica III	913	43.50%	1.10%	4.38%	51.04%	NA
Indica Intermediate	786	35.50%	4.10%	4.83%	55.60%	NA
Temperate Japonica	767	0.10%	88.40%	0.26%	11.21%	NA
Tropical Japonica	504	10.50%	8.70%	0.60%	80.16%	NA
Japonica Intermediate	241	1.70%	60.60%	0.41%	37.34%	NA
VI/Aromatic	96	9.40%	9.40%	4.17%	77.08%	NA
Intermediate	90	27.80%	34.40%	3.33%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002954217	T -> C	LOC_Os10g05840.1	upstream_gene_variant ; 3128.0bp to feature; MODIFIER	silent_mutation	Average:18.938; most accessible tissue: Callus, score: 75.243	N	N	N	N
vg1002954217	T -> C	LOC_Os10g05860.1	downstream_gene_variant ; 4675.0bp to feature; MODIFIER	silent_mutation	Average:18.938; most accessible tissue: Callus, score: 75.243	N	N	N	N
vg1002954217	T -> C	LOC_Os10g05840-LOC_Os10g05860	intergenic_region ; MODIFIER	silent_mutation	Average:18.938; most accessible tissue: Callus, score: 75.243	N	N	N	N
vg1002954217	T -> DEL	N	N	silent_mutation	Average:18.938; most accessible tissue: Callus, score: 75.243	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002954217	6.23E-08	NA	mr1070_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217	3.02E-07	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217	NA	5.76E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217	2.06E-07	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217	9.44E-08	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217	4.45E-08	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217	8.52E-06	NA	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217	1.55E-07	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217	NA	5.43E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217	1.34E-06	NA	mr1437_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251