| Variant ID: vg1002954217 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2954217 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 49. )
AAATTAAATGTGAAATGATACTGTGTGCGGGTCCCACCTGTCAGTCTCTTTCTCTCTTCTCTTCTTCAACCTCTAGCCGTTCCCCATTTACGGCCGGCGG[T/C]
GCTAGGGTTAGCGATTTCGGCGGTGATAGAGGGGGAAAGGGGGTTGCGGCCGAGGAGGGGAGGTAGCTAGGGTTCTCCGGCGACGGCGAGTGGCGGCGGA
TCCGCCGCCACTCGCCGTCGCCGGAGAACCCTAGCTACCTCCCCTCCTCGGCCGCAACCCCCTTTCCCCCTCTATCACCGCCGAAATCGCTAACCCTAGC[A/G]
CCGCCGGCCGTAAATGGGGAACGGCTAGAGGTTGAAGAAGAGAAGAGAGAAAGAGACTGACAGGTGGGACCCGCACACAGTATCATTTCACATTTAATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.10% | 21.60% | 2.71% | 47.63% | NA |
| All Indica | 2759 | 37.20% | 2.90% | 4.13% | 55.82% | NA |
| All Japonica | 1512 | 3.80% | 57.40% | 0.40% | 38.36% | NA |
| Aus | 269 | 77.70% | 12.30% | 0.37% | 9.67% | NA |
| Indica I | 595 | 9.10% | 4.50% | 3.87% | 82.52% | NA |
| Indica II | 465 | 63.70% | 2.20% | 2.80% | 31.40% | NA |
| Indica III | 913 | 43.50% | 1.10% | 4.38% | 51.04% | NA |
| Indica Intermediate | 786 | 35.50% | 4.10% | 4.83% | 55.60% | NA |
| Temperate Japonica | 767 | 0.10% | 88.40% | 0.26% | 11.21% | NA |
| Tropical Japonica | 504 | 10.50% | 8.70% | 0.60% | 80.16% | NA |
| Japonica Intermediate | 241 | 1.70% | 60.60% | 0.41% | 37.34% | NA |
| VI/Aromatic | 96 | 9.40% | 9.40% | 4.17% | 77.08% | NA |
| Intermediate | 90 | 27.80% | 34.40% | 3.33% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002954217 | T -> C | LOC_Os10g05840.1 | upstream_gene_variant ; 3128.0bp to feature; MODIFIER | silent_mutation | Average:18.938; most accessible tissue: Callus, score: 75.243 | N | N | N | N |
| vg1002954217 | T -> C | LOC_Os10g05860.1 | downstream_gene_variant ; 4675.0bp to feature; MODIFIER | silent_mutation | Average:18.938; most accessible tissue: Callus, score: 75.243 | N | N | N | N |
| vg1002954217 | T -> C | LOC_Os10g05840-LOC_Os10g05860 | intergenic_region ; MODIFIER | silent_mutation | Average:18.938; most accessible tissue: Callus, score: 75.243 | N | N | N | N |
| vg1002954217 | T -> DEL | N | N | silent_mutation | Average:18.938; most accessible tissue: Callus, score: 75.243 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002954217 | 6.23E-08 | NA | mr1070_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002954217 | 3.02E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002954217 | NA | 5.76E-07 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002954217 | 2.06E-07 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002954217 | 9.44E-08 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002954217 | 4.45E-08 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002954217 | 8.52E-06 | NA | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002954217 | 1.55E-07 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002954217 | NA | 5.43E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002954217 | 1.34E-06 | NA | mr1437_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |