\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002954217:

Variant ID: vg1002954217 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2954217
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTAAATGTGAAATGATACTGTGTGCGGGTCCCACCTGTCAGTCTCTTTCTCTCTTCTCTTCTTCAACCTCTAGCCGTTCCCCATTTACGGCCGGCGG[T/C]
GCTAGGGTTAGCGATTTCGGCGGTGATAGAGGGGGAAAGGGGGTTGCGGCCGAGGAGGGGAGGTAGCTAGGGTTCTCCGGCGACGGCGAGTGGCGGCGGA

Reverse complement sequence

TCCGCCGCCACTCGCCGTCGCCGGAGAACCCTAGCTACCTCCCCTCCTCGGCCGCAACCCCCTTTCCCCCTCTATCACCGCCGAAATCGCTAACCCTAGC[A/G]
CCGCCGGCCGTAAATGGGGAACGGCTAGAGGTTGAAGAAGAGAAGAGAGAAAGAGACTGACAGGTGGGACCCGCACACAGTATCATTTCACATTTAATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.10% 21.60% 2.71% 47.63% NA
All Indica  2759 37.20% 2.90% 4.13% 55.82% NA
All Japonica  1512 3.80% 57.40% 0.40% 38.36% NA
Aus  269 77.70% 12.30% 0.37% 9.67% NA
Indica I  595 9.10% 4.50% 3.87% 82.52% NA
Indica II  465 63.70% 2.20% 2.80% 31.40% NA
Indica III  913 43.50% 1.10% 4.38% 51.04% NA
Indica Intermediate  786 35.50% 4.10% 4.83% 55.60% NA
Temperate Japonica  767 0.10% 88.40% 0.26% 11.21% NA
Tropical Japonica  504 10.50% 8.70% 0.60% 80.16% NA
Japonica Intermediate  241 1.70% 60.60% 0.41% 37.34% NA
VI/Aromatic  96 9.40% 9.40% 4.17% 77.08% NA
Intermediate  90 27.80% 34.40% 3.33% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002954217 T -> C LOC_Os10g05840.1 upstream_gene_variant ; 3128.0bp to feature; MODIFIER silent_mutation Average:18.938; most accessible tissue: Callus, score: 75.243 N N N N
vg1002954217 T -> C LOC_Os10g05860.1 downstream_gene_variant ; 4675.0bp to feature; MODIFIER silent_mutation Average:18.938; most accessible tissue: Callus, score: 75.243 N N N N
vg1002954217 T -> C LOC_Os10g05840-LOC_Os10g05860 intergenic_region ; MODIFIER silent_mutation Average:18.938; most accessible tissue: Callus, score: 75.243 N N N N
vg1002954217 T -> DEL N N silent_mutation Average:18.938; most accessible tissue: Callus, score: 75.243 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002954217 6.23E-08 NA mr1070_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217 3.02E-07 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217 NA 5.76E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217 2.06E-07 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217 9.44E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217 4.45E-08 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217 8.52E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217 1.55E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217 NA 5.43E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002954217 1.34E-06 NA mr1437_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251