\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002940979:

Variant ID: vg1002940979 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2940979
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.24, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGACCCACATGTTAGTCAAACAAGAAAATAAAAAATAGTGGGACCTACATGTGGGTCCCACTTTCTCCACCTCACCCTCGCTACCTATTATAGATGGC[T/C]
AAATGGGCCGCCCGCCACGGCCGGGCCTGGGCCGAAGTCAGTCAGGCCGACACGGCCCGACTTATACGCCGGGGCATGCCATGCCAGCCCATGGGCTGCA

Reverse complement sequence

TGCAGCCCATGGGCTGGCATGGCATGCCCCGGCGTATAAGTCGGGCCGTGTCGGCCTGACTGACTTCGGCCCAGGCCCGGCCGTGGCGGGCGGCCCATTT[A/G]
GCCATCTATAATAGGTAGCGAGGGTGAGGTGGAGAAAGTGGGACCCACATGTAGGTCCCACTATTTTTTATTTTCTTGTTTGACTAACATGTGGGTCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.10% 21.20% 0.68% 53.09% NA
All Indica  2759 11.00% 2.60% 0.91% 85.50% NA
All Japonica  1512 41.50% 57.10% 0.13% 1.32% NA
Aus  269 76.60% 11.50% 0.37% 11.52% NA
Indica I  595 2.50% 3.50% 1.34% 92.61% NA
Indica II  465 31.00% 1.90% 0.22% 66.88% NA
Indica III  913 4.90% 1.30% 1.10% 92.66% NA
Indica Intermediate  786 12.70% 3.70% 0.76% 82.82% NA
Temperate Japonica  767 11.30% 88.10% 0.00% 0.52% NA
Tropical Japonica  504 88.90% 8.30% 0.20% 2.58% NA
Japonica Intermediate  241 38.20% 60.20% 0.41% 1.24% NA
VI/Aromatic  96 16.70% 10.40% 3.12% 69.79% NA
Intermediate  90 34.40% 28.90% 1.11% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002940979 T -> C LOC_Os10g05810.1 upstream_gene_variant ; 1176.0bp to feature; MODIFIER silent_mutation Average:12.492; most accessible tissue: Callus, score: 70.819 N N N N
vg1002940979 T -> C LOC_Os10g05820.1 downstream_gene_variant ; 822.0bp to feature; MODIFIER silent_mutation Average:12.492; most accessible tissue: Callus, score: 70.819 N N N N
vg1002940979 T -> C LOC_Os10g05810-LOC_Os10g05820 intergenic_region ; MODIFIER silent_mutation Average:12.492; most accessible tissue: Callus, score: 70.819 N N N N
vg1002940979 T -> DEL N N silent_mutation Average:12.492; most accessible tissue: Callus, score: 70.819 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002940979 NA 6.24E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 4.89E-06 NA mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 1.55E-06 1.55E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 1.21E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 7.32E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 6.52E-06 mr1187 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 2.99E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 4.24E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 5.99E-06 5.99E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 7.32E-06 NA mr1327 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 4.97E-06 8.97E-06 mr1327 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 4.78E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 9.11E-06 9.11E-06 mr1331 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 5.62E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 3.22E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 1.92E-06 2.99E-07 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 4.14E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 1.90E-07 1.90E-07 mr1462 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 4.06E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 5.99E-06 5.99E-06 mr1512 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 8.05E-06 2.10E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 2.02E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 2.17E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 1.95E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 1.08E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 9.84E-12 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 2.35E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 1.47E-10 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 1.99E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 1.05E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 5.65E-17 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 2.88E-08 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 6.51E-06 7.38E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 5.53E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 2.52E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 1.65E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 9.00E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 9.23E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 5.55E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 3.00E-06 NA mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 3.98E-07 3.98E-07 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 5.45E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 3.12E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 6.79E-06 1.03E-06 mr1189_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 8.27E-06 6.41E-06 mr1216_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 2.28E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 8.49E-06 mr1472_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 2.46E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 6.79E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 1.25E-06 3.72E-07 mr1734_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 8.83E-07 mr1879_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 4.68E-07 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 4.97E-06 NA mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002940979 NA 1.99E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251