\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002920436:

Variant ID: vg1002920436 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2920436
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACCAATGAAGAAGAAGAAGATTTATGATGATGACTAGCATGCATGCAAGTAGTTGATTTAATTAGCTGCTATGTCCGTCTTGTGCTTTTTTCTTCACGA[C/T]
GACTGTCTCTGTCCGAATCCGTCTCGTGCATGCTCCCCGTGTGATTGAGGCATGCGACGCCGGAGACGCCATCGTGGCCAGCCGTCGCCTGGGGATTACC

Reverse complement sequence

GGTAATCCCCAGGCGACGGCTGGCCACGATGGCGTCTCCGGCGTCGCATGCCTCAATCACACGGGGAGCATGCACGAGACGGATTCGGACAGAGACAGTC[G/A]
TCGTGAAGAAAAAAGCACAAGACGGACATAGCAGCTAATTAAATCAACTACTTGCATGCATGCTAGTCATCATCATAAATCTTCTTCTTCTTCATTGGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 1.00% 0.91% 23.30% NA
All Indica  2759 90.60% 0.00% 0.11% 9.31% NA
All Japonica  1512 53.90% 3.00% 2.58% 40.54% NA
Aus  269 26.40% 0.00% 0.37% 73.23% NA
Indica I  595 98.30% 0.00% 0.00% 1.68% NA
Indica II  465 71.20% 0.00% 0.22% 28.60% NA
Indica III  913 96.10% 0.00% 0.00% 3.94% NA
Indica Intermediate  786 89.80% 0.00% 0.25% 9.92% NA
Temperate Japonica  767 78.90% 5.50% 4.69% 10.95% NA
Tropical Japonica  504 13.10% 0.00% 0.00% 86.90% NA
Japonica Intermediate  241 59.80% 1.20% 1.24% 37.76% NA
VI/Aromatic  96 86.50% 0.00% 0.00% 13.54% NA
Intermediate  90 76.70% 0.00% 0.00% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002920436 C -> T LOC_Os10g05790.1 downstream_gene_variant ; 1330.0bp to feature; MODIFIER silent_mutation Average:62.77; most accessible tissue: Callus, score: 82.643 N N N N
vg1002920436 C -> T LOC_Os10g05800.2 downstream_gene_variant ; 4798.0bp to feature; MODIFIER silent_mutation Average:62.77; most accessible tissue: Callus, score: 82.643 N N N N
vg1002920436 C -> T LOC_Os10g05800.1 downstream_gene_variant ; 4947.0bp to feature; MODIFIER silent_mutation Average:62.77; most accessible tissue: Callus, score: 82.643 N N N N
vg1002920436 C -> T LOC_Os10g05780-LOC_Os10g05790 intergenic_region ; MODIFIER silent_mutation Average:62.77; most accessible tissue: Callus, score: 82.643 N N N N
vg1002920436 C -> DEL N N silent_mutation Average:62.77; most accessible tissue: Callus, score: 82.643 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1002920436 C T 0.01 -0.06 -0.03 0.0 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002920436 1.86E-06 1.77E-06 mr1069 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920436 7.93E-06 NA mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920436 1.46E-07 1.46E-07 mr1861 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251