Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002920436:

Variant ID: vg1002920436 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2920436
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACCAATGAAGAAGAAGAAGATTTATGATGATGACTAGCATGCATGCAAGTAGTTGATTTAATTAGCTGCTATGTCCGTCTTGTGCTTTTTTCTTCACGA[C/T]
GACTGTCTCTGTCCGAATCCGTCTCGTGCATGCTCCCCGTGTGATTGAGGCATGCGACGCCGGAGACGCCATCGTGGCCAGCCGTCGCCTGGGGATTACC

Reverse complement sequence

GGTAATCCCCAGGCGACGGCTGGCCACGATGGCGTCTCCGGCGTCGCATGCCTCAATCACACGGGGAGCATGCACGAGACGGATTCGGACAGAGACAGTC[G/A]
TCGTGAAGAAAAAAGCACAAGACGGACATAGCAGCTAATTAAATCAACTACTTGCATGCATGCTAGTCATCATCATAAATCTTCTTCTTCTTCATTGGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.80%	1.00%	0.91%	23.30%	NA
All Indica	2759	90.60%	0.00%	0.11%	9.31%	NA
All Japonica	1512	53.90%	3.00%	2.58%	40.54%	NA
Aus	269	26.40%	0.00%	0.37%	73.23%	NA
Indica I	595	98.30%	0.00%	0.00%	1.68%	NA
Indica II	465	71.20%	0.00%	0.22%	28.60%	NA
Indica III	913	96.10%	0.00%	0.00%	3.94%	NA
Indica Intermediate	786	89.80%	0.00%	0.25%	9.92%	NA
Temperate Japonica	767	78.90%	5.50%	4.69%	10.95%	NA
Tropical Japonica	504	13.10%	0.00%	0.00%	86.90%	NA
Japonica Intermediate	241	59.80%	1.20%	1.24%	37.76%	NA
VI/Aromatic	96	86.50%	0.00%	0.00%	13.54%	NA
Intermediate	90	76.70%	0.00%	0.00%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002920436	C -> T	LOC_Os10g05790.1	downstream_gene_variant ; 1330.0bp to feature; MODIFIER	silent_mutation	Average:62.77; most accessible tissue: Callus, score: 82.643	N	N	N	N
vg1002920436	C -> T	LOC_Os10g05800.2	downstream_gene_variant ; 4798.0bp to feature; MODIFIER	silent_mutation	Average:62.77; most accessible tissue: Callus, score: 82.643	N	N	N	N
vg1002920436	C -> T	LOC_Os10g05800.1	downstream_gene_variant ; 4947.0bp to feature; MODIFIER	silent_mutation	Average:62.77; most accessible tissue: Callus, score: 82.643	N	N	N	N
vg1002920436	C -> T	LOC_Os10g05780-LOC_Os10g05790	intergenic_region ; MODIFIER	silent_mutation	Average:62.77; most accessible tissue: Callus, score: 82.643	N	N	N	N
vg1002920436	C -> DEL	N	N	silent_mutation	Average:62.77; most accessible tissue: Callus, score: 82.643	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1002920436	C	T	0.01	-0.06	-0.03	0.0	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002920436	1.86E-06	1.77E-06	mr1069	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920436	7.93E-06	NA	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002920436	1.46E-07	1.46E-07	mr1861	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251