\
| Variant ID: vg1002918909 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2918909 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.18, others allele: 0.00, population size: 99. )
GAGGATTGCTCCCACCTTTTAAGTCATACTCCCCATCATCAATTACCGATCACTGGTGGAGAAACCATCTTTGGTCGGTCGGCCGAAATCCACAATAGTC[T/C]
CGGTTCCACTAAAAACCGGTTCAAAAGATGATCTTTAGTCCCGGTTCAAAAGGTTAGAGCTACTTTTTGATCTTTAGTCCCGGTTGGTAACATCAACCGG
CCGGTTGATGTTACCAACCGGGACTAAAGATCAAAAAGTAGCTCTAACCTTTTGAACCGGGACTAAAGATCATCTTTTGAACCGGTTTTTAGTGGAACCG[A/G]
GACTATTGTGGATTTCGGCCGACCGACCAAAGATGGTTTCTCCACCAGTGATCGGTAATTGATGATGGGGAGTATGACTTAAAAGGTGGGAGCAATCCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 21.10% | 1.33% | 21.58% | NA |
| All Indica | 2759 | 89.50% | 1.80% | 1.27% | 7.47% | NA |
| All Japonica | 1512 | 2.10% | 57.40% | 0.53% | 40.01% | NA |
| Aus | 269 | 12.60% | 16.00% | 6.32% | 65.06% | NA |
| Indica I | 595 | 97.80% | 0.30% | 0.17% | 1.68% | NA |
| Indica II | 465 | 70.10% | 2.80% | 1.94% | 25.16% | NA |
| Indica III | 913 | 95.70% | 0.90% | 0.66% | 2.74% | NA |
| Indica Intermediate | 786 | 87.40% | 3.30% | 2.42% | 6.87% | NA |
| Temperate Japonica | 767 | 0.70% | 88.10% | 0.39% | 10.82% | NA |
| Tropical Japonica | 504 | 4.00% | 9.10% | 0.99% | 85.91% | NA |
| Japonica Intermediate | 241 | 2.50% | 60.60% | 0.00% | 36.93% | NA |
| VI/Aromatic | 96 | 77.10% | 9.40% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 43.30% | 30.00% | 3.33% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002918909 | T -> C | LOC_Os10g05780.1 | upstream_gene_variant ; 4196.0bp to feature; MODIFIER | silent_mutation | Average:59.583; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg1002918909 | T -> C | LOC_Os10g05790.1 | downstream_gene_variant ; 2857.0bp to feature; MODIFIER | silent_mutation | Average:59.583; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg1002918909 | T -> C | LOC_Os10g05780-LOC_Os10g05790 | intergenic_region ; MODIFIER | silent_mutation | Average:59.583; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg1002918909 | T -> DEL | N | N | silent_mutation | Average:59.583; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002918909 | NA | 1.12E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 3.62E-07 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 4.05E-09 | mr1715 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 1.91E-07 | mr1736 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 1.57E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 9.80E-18 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 7.37E-08 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 1.07E-14 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 1.58E-07 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 9.63E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 6.45E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 2.77E-08 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002918909 | NA | 2.48E-07 | mr1715_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |