\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002908137:

Variant ID: vg1002908137 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2908137
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGGTTTTCTCCATGTCTGGTGAGTTTGATTTATCTATTTGGTTATGACATCGGTTATCTAGCCATGGATTATATCAAGTCATACTTAAGACGGTAGAT[A/G]
GAGGTGAACATGGTCTTCGAGAAGTCTATGATGTGACAGCTAGGAAGAATTCAATTCGCTTGGCAAGATGACTGTGGTGATATGAGAGAAGGTGGAGCAT

Reverse complement sequence

ATGCTCCACCTTCTCTCATATCACCACAGTCATCTTGCCAAGCGAATTGAATTCTTCCTAGCTGTCACATCATAGACTTCTCGAAGACCATGTTCACCTC[T/C]
ATCTACCGTCTTAAGTATGACTTGATATAATCCATGGCTAGATAACCGATGTCATAACCAAATAGATAAATCAAACTCACCAGACATGGAGAAAACCCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.00% 19.10% 0.97% 53.89% NA
All Indica  2759 11.30% 1.20% 0.65% 86.77% NA
All Japonica  1512 43.60% 53.30% 1.72% 1.39% NA
Aus  269 77.00% 11.50% 0.00% 11.52% NA
Indica I  595 2.00% 1.20% 0.67% 96.13% NA
Indica II  465 32.00% 0.90% 0.00% 67.10% NA
Indica III  913 5.30% 0.70% 0.55% 93.54% NA
Indica Intermediate  786 13.20% 2.20% 1.15% 83.46% NA
Temperate Japonica  767 15.30% 82.90% 1.30% 0.52% NA
Tropical Japonica  504 88.90% 7.90% 0.60% 2.58% NA
Japonica Intermediate  241 39.00% 53.90% 5.39% 1.66% NA
VI/Aromatic  96 17.70% 10.40% 1.04% 70.83% NA
Intermediate  90 35.60% 26.70% 1.11% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002908137 A -> G LOC_Os10g05780.1 downstream_gene_variant ; 4617.0bp to feature; MODIFIER silent_mutation Average:10.031; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1002908137 A -> G LOC_Os10g05770.1 intron_variant ; MODIFIER silent_mutation Average:10.031; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1002908137 A -> DEL N N silent_mutation Average:10.031; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002908137 NA 4.13E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 1.40E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 7.61E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 2.00E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 9.43E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 1.88E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 1.23E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 1.74E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 1.00E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 8.84E-08 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 9.65E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 5.45E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 3.78E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 1.93E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 1.60E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 1.07E-06 1.07E-06 mr1736 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 1.72E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 6.43E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 5.51E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 4.52E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 6.10E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 8.27E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002908137 NA 2.07E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251