\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002906134:

Variant ID: vg1002906134 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2906134
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


CGACTACACAGGGTGTCCAGGGACGGACATGGATGCAAGGTGGAGCACGGCGGCGATCAACGGAATTTGATCGGTGGAATCGGACACTTCAGGCGGCGGT[T/C]
TGAACCGTTTGATGGCTGCAATCAACAAGGAGATGACCAGACGTGGTGCTCGGGTTGATGGCGGCGGAAGCGATTGGCAATCCAATCGGTGGGTCGGACA

Reverse complement sequence

TGTCCGACCCACCGATTGGATTGCCAATCGCTTCCGCCGCCATCAACCCGAGCACCACGTCTGGTCATCTCCTTGTTGATTGCAGCCATCAAACGGTTCA[A/G]
ACCGCCGCCTGAAGTGTCCGATTCCACCGATCAAATTCCGTTGATCGCCGCCGTGCTCCACCTTGCATCCATGTCCGTCCCTGGACACCCTGTGTAGTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.80% 21.10% 23.78% 33.39% NA
All Indica  2759 1.40% 9.10% 34.14% 55.38% NA
All Japonica  1512 56.10% 41.50% 1.59% 0.86% NA
Aus  269 29.40% 29.70% 38.66% 2.23% NA
Indica I  595 1.00% 6.60% 29.24% 63.19% NA
Indica II  465 0.90% 8.40% 50.97% 39.78% NA
Indica III  913 0.80% 9.90% 27.71% 61.66% NA
Indica Intermediate  786 2.80% 10.40% 35.37% 51.40% NA
Temperate Japonica  767 88.10% 11.10% 0.13% 0.65% NA
Tropical Japonica  504 7.90% 89.30% 1.59% 1.19% NA
Japonica Intermediate  241 54.80% 38.20% 6.22% 0.83% NA
VI/Aromatic  96 36.50% 16.70% 35.42% 11.46% NA
Intermediate  90 30.00% 25.60% 22.22% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002906134 T -> C LOC_Os10g05770.1 intron_variant ; MODIFIER silent_mutation Average:23.699; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1002906134 T -> DEL N N silent_mutation Average:23.699; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002906134 NA 1.92E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 6.24E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 1.21E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 7.32E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 2.99E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 4.78E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 3.22E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 4.14E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 3.23E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 6.44E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 4.06E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 2.17E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 1.95E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 9.84E-12 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 2.95E-20 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 1.47E-10 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 1.99E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 4.42E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 1.05E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 3.83E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 5.65E-17 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 2.59E-06 2.59E-06 mr1736 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 2.88E-08 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 8.12E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 1.75E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 1.25E-19 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 2.52E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 2.35E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 6.16E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 1.65E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 9.23E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 5.55E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 1.68E-15 mr1982 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 5.45E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 3.12E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 2.46E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 6.79E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002906134 NA 1.99E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251