Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002866098:

Variant ID: vg1002866098 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2866098
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GATGATTTTGTGATTTTGTGAATGATTTGTGATGTATTTGGGGATAGAAAATGCAGCTTGATGTATTTAGGGATTTTTTGAATGATACGTGGTGTTCGAA[A/T]
GATTTGTGGAGATTCGTGGGGCTCGAAATCATGCAAGCAGCAGGAAACCAAAAAAAAAAAGAAAAAAGAGCATTAGTCCCGGTTCGGAACTCCAACCGGG

Reverse complement sequence

CCCGGTTGGAGTTCCGAACCGGGACTAATGCTCTTTTTTCTTTTTTTTTTTGGTTTCCTGCTGCTTGCATGATTTCGAGCCCCACGAATCTCCACAAATC[T/A]
TTCGAACACCACGTATCATTCAAAAAATCCCTAAATACATCAAGCTGCATTTTCTATCCCCAAATACATCACAAATCATTCACAAAATCACAAAATCATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	20.30%	2.81%	13.33%	NA
All Indica	2759	96.60%	1.20%	1.67%	0.54%	NA
All Japonica	1512	2.50%	56.90%	2.25%	38.29%	NA
Aus	269	65.10%	11.20%	15.61%	8.18%	NA
Indica I	595	98.80%	0.30%	0.34%	0.50%	NA
Indica II	465	98.30%	1.10%	0.22%	0.43%	NA
Indica III	913	95.00%	1.20%	3.29%	0.55%	NA
Indica Intermediate	786	95.70%	2.00%	1.65%	0.64%	NA
Temperate Japonica	767	1.20%	87.90%	0.26%	10.69%	NA
Tropical Japonica	504	4.00%	8.50%	4.17%	83.33%	NA
Japonica Intermediate	241	3.70%	59.80%	4.56%	31.95%	NA
VI/Aromatic	96	75.00%	12.50%	7.29%	5.21%	NA
Intermediate	90	61.10%	24.40%	4.44%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002866098	A -> T	LOC_Os10g05695.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:48.712; most accessible tissue: Minghui63 flag leaf, score: 78.472	N	N	N	N
vg1002866098	A -> T	LOC_Os10g05695.1	5_prime_UTR_variant ; 1103.0bp to feature; MODIFIER	silent_mutation	Average:48.712; most accessible tissue: Minghui63 flag leaf, score: 78.472	N	N	N	N
vg1002866098	A -> DEL	N	N	silent_mutation	Average:48.712; most accessible tissue: Minghui63 flag leaf, score: 78.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002866098	NA	4.07E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	1.60E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	2.38E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	7.86E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	7.53E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	1.54E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	1.42E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	6.74E-21	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	6.51E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	8.74E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	8.30E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	1.43E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	1.64E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	1.88E-07	2.03E-22	mr1768	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	4.99E-06	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	1.34E-07	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	7.50E-07	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	8.04E-07	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	2.48E-09	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	1.18E-06	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	1.01E-22	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	6.60E-08	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	3.62E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	9.84E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	7.09E-30	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098	NA	4.87E-07	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251