\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002866098:

Variant ID: vg1002866098 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2866098
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GATGATTTTGTGATTTTGTGAATGATTTGTGATGTATTTGGGGATAGAAAATGCAGCTTGATGTATTTAGGGATTTTTTGAATGATACGTGGTGTTCGAA[A/T]
GATTTGTGGAGATTCGTGGGGCTCGAAATCATGCAAGCAGCAGGAAACCAAAAAAAAAAAGAAAAAAGAGCATTAGTCCCGGTTCGGAACTCCAACCGGG

Reverse complement sequence

CCCGGTTGGAGTTCCGAACCGGGACTAATGCTCTTTTTTCTTTTTTTTTTTGGTTTCCTGCTGCTTGCATGATTTCGAGCCCCACGAATCTCCACAAATC[T/A]
TTCGAACACCACGTATCATTCAAAAAATCCCTAAATACATCAAGCTGCATTTTCTATCCCCAAATACATCACAAATCATTCACAAAATCACAAAATCATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 20.30% 2.81% 13.33% NA
All Indica  2759 96.60% 1.20% 1.67% 0.54% NA
All Japonica  1512 2.50% 56.90% 2.25% 38.29% NA
Aus  269 65.10% 11.20% 15.61% 8.18% NA
Indica I  595 98.80% 0.30% 0.34% 0.50% NA
Indica II  465 98.30% 1.10% 0.22% 0.43% NA
Indica III  913 95.00% 1.20% 3.29% 0.55% NA
Indica Intermediate  786 95.70% 2.00% 1.65% 0.64% NA
Temperate Japonica  767 1.20% 87.90% 0.26% 10.69% NA
Tropical Japonica  504 4.00% 8.50% 4.17% 83.33% NA
Japonica Intermediate  241 3.70% 59.80% 4.56% 31.95% NA
VI/Aromatic  96 75.00% 12.50% 7.29% 5.21% NA
Intermediate  90 61.10% 24.40% 4.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002866098 A -> T LOC_Os10g05695.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:48.712; most accessible tissue: Minghui63 flag leaf, score: 78.472 N N N N
vg1002866098 A -> T LOC_Os10g05695.1 5_prime_UTR_variant ; 1103.0bp to feature; MODIFIER silent_mutation Average:48.712; most accessible tissue: Minghui63 flag leaf, score: 78.472 N N N N
vg1002866098 A -> DEL N N silent_mutation Average:48.712; most accessible tissue: Minghui63 flag leaf, score: 78.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002866098 NA 4.07E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 1.60E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 2.38E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 7.86E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 7.53E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 1.54E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 1.42E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 6.74E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 6.51E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 8.74E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 8.30E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 1.43E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 1.64E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 1.88E-07 2.03E-22 mr1768 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 4.99E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 1.34E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 7.50E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 8.04E-07 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 2.48E-09 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 1.18E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 1.01E-22 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 6.60E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 3.62E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 9.84E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 7.09E-30 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002866098 NA 4.87E-07 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251